EMAIL THIS PAGE TO A FRIEND

SLC6A17

solute carrier family 6 (neutral amino acid transporter), member 17

Synonyms: NTT4
UniProtKB ID: Q9H1V8, A6NEA8, A8K1R7, B9EIR5, Q5T5Q9
Gene ID:
Human(388662) Summary: The SLC6 family of proteins, which includes SLC6A17, acts as specific transporters for neurotransmitters, amino acids, and osmolytes like betaine, taurine, and creatine. SLC6 proteins are sodium cotransporters that derive the energy for solute transport from the electrochemical gradient for sodium ions (Hoglund et al., 2005 [PubMed 16125675]
Mouse(229706) solute carrier family 6 (neurotransmitter transporter), member 17
Rat(613226) solute carrier family 6 (neutral amino acid transporter), member 17
domestic guinea pig(100734209) solute carrier family 6, member 17
naked mole-rat(101713843) solute carrier family 6, member 17
cow(407174) solute carrier family 6, member 17
sheep(101110465) solute carrier family 6, member 17
Zebrafish(798635) solute carrier family 6, member 17
chicken(419805) solute carrier family 6, member 17
dog(490115) solute carrier family 6, member 17
Horse(100058458) solute carrier family 6, member 17
domestic cat(101081318) solute carrier family 6, member 17
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_371280 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_371280 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_371280 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172271 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172271 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172271 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU057421 MISSION® esiRNA esiRNA human SLC6A17 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010898 Rosetta Predictions human pricing
NM_001033079 Rosetta Predictions rat pricing
NM_172271 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010898 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204421 predicted 2000
2 SASI_Hs01_00204422 predicted 927
3 SASI_Hs01_00204423 predicted 1775
4 SASI_Hs01_00204424 predicted 746
5 SASI_Hs01_00204425 predicted 1421
6 SASI_Hs01_00204426 predicted 574
7 SASI_Hs01_00204427 predicted 2168
8 SASI_Hs01_00204428 predicted 1661
9 SASI_Hs01_00204429 predicted 551
10 SASI_Hs01_00204430 predicted 1633
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033079 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038777 predicted 1321
2 SASI_Rn01_00038778 predicted 506
3 SASI_Rn02_00203644 predicted 959
4 SASI_Rn02_00203645 predicted 1212
5 SASI_Rn01_00038780 predicted 1547
6 SASI_Rn02_00203646 predicted 1787
7 SASI_Rn01_00038781 predicted 1702
8 SASI_Rn01_00038782 predicted 910
9 SASI_Rn01_00038783 predicted 1539
10 SASI_Rn01_00038784 predicted 2165
11 SASI_Rn01_00038779 predicted 2188
12 SASI_Rn01_00038785 predicted 1651
13 SASI_Rn01_00038786 predicted 1058
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172271 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106612 predicted 1354
2 SASI_Mm01_00106613 predicted 1683
3 SASI_Mm01_00106615 predicted 2202
4 SASI_Mm01_00106616 predicted 537
5 SASI_Mm01_00106617 predicted 2123
6 SASI_Mm01_00106618 predicted 2178
7 SASI_Mm01_00106619 predicted 928
8 SASI_Mm01_00106621 predicted 2478
9 SASI_Mm02_00343749 predicted 2129
10 SASI_Mm02_00343750 predicted 786
11 SASI_Mm01_00106614 predicted 1244
12 SASI_Mm01_00106620 predicted 1579
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_371280
SLC6A17 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 6 (neutral amino acid transporter), member 17
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371280.1-1430s1c1
Sequence:CCGGCCTGGATTTATGGAACCAAGACTCGAGTCTTGGTTCCATAAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371280.1-898s1c1
Sequence:CCGGGTGGTCGAGAATGCTGAGAAACTCGAGTTTCTCAGCATTCTCGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371280.1-759s1c1
Sequence:CCGGCAGCTACAATAAGCAGGACAACTCGAGTTGTCCTGCTTATTGTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371280.1-231s1c1
Sequence:CCGGCGGGTGGAGCATCTTCTATTTCTCGAGAAATAGAAGATGCTCCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371280.1-1344s1c1
Sequence:CCGGCGGAAACTACTTTGTCACCATCTCGAGATGGTGACAAAGTAGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_371280
SLC6A17 MISSION shRNA shRNA Plasmid DNA
solute carrier family 6 (neutral amino acid transporter), member 17
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371280.1-1430s1c1
Sequence:CCGGCCTGGATTTATGGAACCAAGACTCGAGTCTTGGTTCCATAAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371280.1-898s1c1
Sequence:CCGGGTGGTCGAGAATGCTGAGAAACTCGAGTTTCTCAGCATTCTCGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371280.1-759s1c1
Sequence:CCGGCAGCTACAATAAGCAGGACAACTCGAGTTGTCCTGCTTATTGTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371280.1-231s1c1
Sequence:CCGGCGGGTGGAGCATCTTCTATTTCTCGAGAAATAGAAGATGCTCCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371280.1-1344s1c1
Sequence:CCGGCGGAAACTACTTTGTCACCATCTCGAGATGGTGACAAAGTAGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_371280
SLC6A17 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 6 (neutral amino acid transporter), member 17
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371280.1-1430s1c1
Sequence:CCGGCCTGGATTTATGGAACCAAGACTCGAGTCTTGGTTCCATAAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371280.1-898s1c1
Sequence:CCGGGTGGTCGAGAATGCTGAGAAACTCGAGTTTCTCAGCATTCTCGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371280.1-759s1c1
Sequence:CCGGCAGCTACAATAAGCAGGACAACTCGAGTTGTCCTGCTTATTGTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371280.1-231s1c1
Sequence:CCGGCGGGTGGAGCATCTTCTATTTCTCGAGAAATAGAAGATGCTCCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371280.1-1344s1c1
Sequence:CCGGCGGAAACTACTTTGTCACCATCTCGAGATGGTGACAAAGTAGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172271
VALIDATED
SLC6A17 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 6 (neutral amino acid transporter), member 17
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079733    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172271.1-4380s1c1
Sequence:CCGGGCCATCTCTTATTCCTCAGTTCTCGAGAACTGAGGAATAAGAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172271.1-1463s1c1
Sequence:CCGGGCTACAACAAACAGGACAATACTCGAGTATTGTCCTGTTTGTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172271.1-2178s1c1
Sequence:CCGGCCAGCCGTATCGATTCTATTTCTCGAGAAATAGAATCGATACGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172271.1-2181s1c1
Sequence:CCGGGCCGTATCGATTCTATTTCTACTCGAGTAGAAATAGAATCGATACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172271.1-1244s1c1
Sequence:CCGGCCTCTGGAAAGGTAATGTATTCTCGAGAATACATTACCTTTCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172271
VALIDATED
SLC6A17 MISSION shRNA shRNA Plasmid DNA
solute carrier family 6 (neutral amino acid transporter), member 17
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079733    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172271.1-4380s1c1
Sequence:CCGGGCCATCTCTTATTCCTCAGTTCTCGAGAACTGAGGAATAAGAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172271.1-1463s1c1
Sequence:CCGGGCTACAACAAACAGGACAATACTCGAGTATTGTCCTGTTTGTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172271.1-2178s1c1
Sequence:CCGGCCAGCCGTATCGATTCTATTTCTCGAGAAATAGAATCGATACGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172271.1-2181s1c1
Sequence:CCGGGCCGTATCGATTCTATTTCTACTCGAGTAGAAATAGAATCGATACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172271.1-1244s1c1
Sequence:CCGGCCTCTGGAAAGGTAATGTATTCTCGAGAATACATTACCTTTCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172271
VALIDATED
SLC6A17 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 6 (neutral amino acid transporter), member 17
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079733    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172271.1-4380s1c1
Sequence:CCGGGCCATCTCTTATTCCTCAGTTCTCGAGAACTGAGGAATAAGAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172271.1-1463s1c1
Sequence:CCGGGCTACAACAAACAGGACAATACTCGAGTATTGTCCTGTTTGTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172271.1-2178s1c1
Sequence:CCGGCCAGCCGTATCGATTCTATTTCTCGAGAAATAGAATCGATACGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172271.1-2181s1c1
Sequence:CCGGGCCGTATCGATTCTATTTCTACTCGAGTAGAAATAGAATCGATACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172271.1-1244s1c1
Sequence:CCGGCCTCTGGAAAGGTAATGTATTCTCGAGAATACATTACCTTTCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks