EMAIL THIS PAGE TO A FRIEND

SLC6A20

solute carrier family 6 (proline IMINO transporter), member 20

Synonyms: SIT1 XT3 Xtrp3
UniProtKB ID: Q9NP91, A1A4F2, O75590, Q8TF10, Q9NPQ2, Q9NQ77
Gene ID:
Human(54716) Summary: Transport of small hydrophilic substances across cell membranes is mediated by substrate-specific transporter proteins which have been classified into several families of related genes. The protein encoded by this gene is a member of the subgroup of transporter with unidentified substrates within the Na+ and Cl- coupled transporter family. This gene is expressed in kidney, and its alternative splicing generates 2 transcript variants. [provided by RefSeq, Jul 2008]
Rat(113918) solute carrier family 6 (proline IMINO transporter), member 20
domestic guinea pig(100714792) solute carrier family 6 (proline IMINO transporter), member 20
naked mole-rat(101697646) solute carrier family 6 (proline IMINO transporter), member 20
Domestic Rabbit(100346971) solute carrier family 6 (proline IMINO transporter), member 20
cow(532774) solute carrier family 6 (proline IMINO transporter), member 20
sheep(101104534) solute carrier family 6 (proline IMINO transporter), member 20
chicken(420699) solute carrier family 6 (proline IMINO transporter), member 20
domestic cat(101092749) solute carrier family 6 (proline IMINO transporter), member 20
Horse(100054556) solute carrier family 6 (proline IMINO transporter), member 20
dog(484794) solute carrier family 6 (proline IMINO transporter), member 20
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020208 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020208 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020208 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU070141 MISSION® esiRNA esiRNA human SLC6A20 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020208 Rosetta Predictions human pricing
NM_022405 Rosetta Predictions human pricing
NM_133296 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020208 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153475 predicted 1561
2 SASI_Hs01_00153476 predicted 1923
3 SASI_Hs01_00153477 predicted 1877
4 SASI_Hs01_00153478 predicted 2055
5 SASI_Hs01_00153479 predicted 2057
6 SASI_Hs01_00153480 predicted 1859
7 SASI_Hs01_00153481 predicted 2109
8 SASI_Hs02_00353143 predicted 2126
9 SASI_Hs01_00153482 predicted 2107
10 SASI_Hs01_00153484 predicted 1872
11 SASI_Hs01_00153483 predicted 1187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022405 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066107 predicted 1453
2 SASI_Hs01_00066108 predicted 1816
3 SASI_Hs01_00066109 predicted 1768
4 SASI_Hs01_00066110 predicted 1940
5 SASI_Hs01_00066111 predicted 1941
6 SASI_Hs01_00066112 predicted 1750
7 SASI_Hs01_00066113 predicted 1992
8 SASI_Hs02_00355686 predicted 2014
9 SASI_Hs01_00066114 predicted 2002
10 SASI_Hs01_00066116 predicted 1759
11 SASI_Hs01_00066115 predicted 1069
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133296 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101223 predicted 231
2 SASI_Rn01_00101224 predicted 739
3 SASI_Rn01_00101225 predicted 1023
4 SASI_Rn01_00101226 predicted 983
5 SASI_Rn01_00101227 predicted 665
6 SASI_Rn01_00101228 predicted 418
7 SASI_Rn02_00267582 predicted 420
8 SASI_Rn01_00101229 predicted 792
9 SASI_Rn01_00101230 predicted 235
10 SASI_Rn01_00101231 predicted 727
11 SASI_Rn01_00101232 predicted 1906
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020208
SLC6A20 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 6 (proline IMINO transporter), member 20
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020208.3-1483s21c1
Sequence:CCGGGAACTACTGGTTTGACATATTCTCGAGAATATGTCAAACCAGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020208.3-2195s21c1
Sequence:CCGGGCACATTGCAAACTGAAATATCTCGAGATATTTCAGTTTGCAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425712    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020208.3-2138s21c1
Sequence:CCGGGAAAGCCGGTCTCAAAGATAACTCGAGTTATCTTTGAGACCGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020208.2-1512s1c1
Sequence:CCGGGAGATTTGAAAGTGACCTTAACTCGAGTTAAGGTCACTTTCAAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020208.2-1594s1c1
Sequence:CCGGCTGCTGATTGTCAGCCTCTTTCTCGAGAAAGAGGCTGACAATCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020208.2-348s1c1
Sequence:CCGGCATGTACTACAACGTCATCAACTCGAGTTGATGACGTTGTAGTACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020208.2-1098s1c1
Sequence:CCGGCGAGATGTTCCCGCAAATCAACTCGAGTTGATTTGCGGGAACATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020208.2-897s1c1
Sequence:CCGGCAACAGCTTCACCTCCATATTCTCGAGAATATGGAGGTGAAGCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020208
SLC6A20 MISSION shRNA shRNA Plasmid DNA
solute carrier family 6 (proline IMINO transporter), member 20
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020208.3-1483s21c1
Sequence:CCGGGAACTACTGGTTTGACATATTCTCGAGAATATGTCAAACCAGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020208.3-2195s21c1
Sequence:CCGGGCACATTGCAAACTGAAATATCTCGAGATATTTCAGTTTGCAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425712    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020208.3-2138s21c1
Sequence:CCGGGAAAGCCGGTCTCAAAGATAACTCGAGTTATCTTTGAGACCGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020208.2-1512s1c1
Sequence:CCGGGAGATTTGAAAGTGACCTTAACTCGAGTTAAGGTCACTTTCAAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020208.2-1594s1c1
Sequence:CCGGCTGCTGATTGTCAGCCTCTTTCTCGAGAAAGAGGCTGACAATCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020208.2-348s1c1
Sequence:CCGGCATGTACTACAACGTCATCAACTCGAGTTGATGACGTTGTAGTACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020208.2-1098s1c1
Sequence:CCGGCGAGATGTTCCCGCAAATCAACTCGAGTTGATTTGCGGGAACATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020208.2-897s1c1
Sequence:CCGGCAACAGCTTCACCTCCATATTCTCGAGAATATGGAGGTGAAGCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020208
SLC6A20 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 6 (proline IMINO transporter), member 20
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020208.3-1483s21c1
Sequence:CCGGGAACTACTGGTTTGACATATTCTCGAGAATATGTCAAACCAGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020208.3-2195s21c1
Sequence:CCGGGCACATTGCAAACTGAAATATCTCGAGATATTTCAGTTTGCAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425712    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020208.3-2138s21c1
Sequence:CCGGGAAAGCCGGTCTCAAAGATAACTCGAGTTATCTTTGAGACCGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020208.2-1512s1c1
Sequence:CCGGGAGATTTGAAAGTGACCTTAACTCGAGTTAAGGTCACTTTCAAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020208.2-1594s1c1
Sequence:CCGGCTGCTGATTGTCAGCCTCTTTCTCGAGAAAGAGGCTGACAATCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020208.2-348s1c1
Sequence:CCGGCATGTACTACAACGTCATCAACTCGAGTTGATGACGTTGTAGTACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020208.2-1098s1c1
Sequence:CCGGCGAGATGTTCCCGCAAATCAACTCGAGTTGATTTGCGGGAACATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020208.2-897s1c1
Sequence:CCGGCAACAGCTTCACCTCCATATTCTCGAGAATATGGAGGTGAAGCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks