EMAIL THIS PAGE TO A FRIEND

SLC7A4

solute carrier family 7, member 4

Synonyms: CAT-4 CAT4 HCAT3 VH
UniProtKB ID: O43246, Q0P5U2, Q3KNQ6, Q4VC45, Q6IBY8, Q96H88
Gene ID:
Mouse(224022) solute carrier family 7 (cationic amino acid transporter, y+ system), member 4
Rat(303787) solute carrier family 7, member 4
Zebrafish(796100) solute carrier family 7 (cationic amino acid transporter, y+ system), member 4
chicken(427062) solute carrier family 7 (orphan transporter), member 4
domestic cat(101083298) solute carrier family 7 (orphan transporter), member 4
Horse(100146527) solute carrier family 7 (orphan transporter), member 4
Horse(100056096) solute carrier family 7 (orphan transporter), member 4
dog(486435) solute carrier family 7 (orphan transporter), member 4
cow(504923) solute carrier family 7 (orphan transporter), member 4
domestic guinea pig(100732707) solute carrier family 7 (orphan transporter), member 4
naked mole-rat(101700946) solute carrier family 7 (orphan transporter), member 4
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV43869 Anti-SLC7A4 antibody produced in rabbit affinity isolated antibody mouse, bovine, canine, zebrafish, human, rat, horse, rabbit, guinea pig
western blot pricing
HPA031023 Anti-SLC7A4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144852 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144852 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144852 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004173 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004173 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004173 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU000461 MISSION® esiRNA esiRNA targeting human SLC7A4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004173 Rosetta Predictions human pricing
NM_001107078 Rosetta Predictions rat pricing
NM_144852 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004173 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169793 predicted 367
2 SASI_Hs01_00169795 predicted 1664
3 SASI_Hs01_00169796 predicted 1281
4 SASI_Hs01_00169797 predicted 1863
5 SASI_Hs01_00169798 predicted 266
6 SASI_Hs01_00169799 predicted 423
7 SASI_Hs01_00169800 predicted 1082
8 SASI_Hs01_00169801 predicted 1793
9 SASI_Hs01_00169802 predicted 1252
10 SASI_Hs02_00337055 predicted 376
11 SASI_Hs01_00169794 predicted 681
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107078 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225276 predicted 699
2 SASI_Rn02_00225277 predicted 1011
3 SASI_Rn02_00225278 predicted 537
4 SASI_Rn02_00225279 predicted 382
5 SASI_Rn02_00225280 predicted 1651
6 SASI_Rn02_00225281 predicted 647
7 SASI_Rn02_00225282 predicted 504
8 SASI_Rn02_00225283 predicted 1994
9 SASI_Rn02_00225284 predicted 1263
10 SASI_Rn02_00225285 predicted 784
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144852 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133392 predicted 418
2 SASI_Mm01_00133393 predicted 395
3 SASI_Mm01_00133394 predicted 551
4 SASI_Mm01_00133395 predicted 712
5 SASI_Mm01_00133396 predicted 1290
6 SASI_Mm01_00133397 predicted 803
7 SASI_Mm01_00133398 predicted 661
8 SASI_Mm01_00133400 predicted 2027
9 SASI_Mm01_00133401 predicted 437
10 SASI_Mm02_00340262 predicted 1256
11 SASI_Mm01_00133399 predicted 1533
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144852
SLC7A4 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 7, member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144852.1-1656s1c1
Sequence:CCGGGCTGCCTACTTAAGGAAGCTTCTCGAGAAGCTTCCTTAAGTAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144852.1-414s1c1
Sequence:CCGGGCCCTATGCTATGCAGAGTTTCTCGAGAAACTCTGCATAGCATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144852.1-1127s1c1
Sequence:CCGGTGGCTCTATCTGTGCCATGAACTCGAGTTCATGGCACAGATAGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144852.1-650s1c1
Sequence:CCGGCCTAGCTCACTATCCAGATTTCTCGAGAAATCTGGATAGTGAGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144852.1-501s1c1
Sequence:CCGGGCATTCCTCATAGGCTGGAATCTCGAGATTCCAGCCTATGAGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144852
SLC7A4 MISSION shRNA shRNA Plasmid DNA
solute carrier family 7, member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144852.1-1656s1c1
Sequence:CCGGGCTGCCTACTTAAGGAAGCTTCTCGAGAAGCTTCCTTAAGTAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144852.1-414s1c1
Sequence:CCGGGCCCTATGCTATGCAGAGTTTCTCGAGAAACTCTGCATAGCATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144852.1-1127s1c1
Sequence:CCGGTGGCTCTATCTGTGCCATGAACTCGAGTTCATGGCACAGATAGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144852.1-650s1c1
Sequence:CCGGCCTAGCTCACTATCCAGATTTCTCGAGAAATCTGGATAGTGAGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144852.1-501s1c1
Sequence:CCGGGCATTCCTCATAGGCTGGAATCTCGAGATTCCAGCCTATGAGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144852
SLC7A4 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 7, member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144852.1-1656s1c1
Sequence:CCGGGCTGCCTACTTAAGGAAGCTTCTCGAGAAGCTTCCTTAAGTAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144852.1-414s1c1
Sequence:CCGGGCCCTATGCTATGCAGAGTTTCTCGAGAAACTCTGCATAGCATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144852.1-1127s1c1
Sequence:CCGGTGGCTCTATCTGTGCCATGAACTCGAGTTCATGGCACAGATAGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144852.1-650s1c1
Sequence:CCGGCCTAGCTCACTATCCAGATTTCTCGAGAAATCTGGATAGTGAGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144852.1-501s1c1
Sequence:CCGGGCATTCCTCATAGGCTGGAATCTCGAGATTCCAGCCTATGAGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004173
SLC7A4 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 7, member 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004173.1-334s1c1
Sequence:CCGGGCCCTATGCTATGCAGAATTTCTCGAGAAATTCTGCATAGCATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004173.1-1884s1c1
Sequence:CCGGCTCCACACACTACGTGGTATTCTCGAGAATACCACGTAGTGTGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004173.1-434s1c1
Sequence:CCGGGCTGGAATGTTCTCCTCGAATCTCGAGATTCGAGGAGAACATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004173.1-1816s1c1
Sequence:CCGGCTTGCAGTGTATTTCGGCTATCTCGAGATAGCCGAAATACACTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004173.1-1677s1c1
Sequence:CCGGGCAACAGTATCGGGAAGACTTCTCGAGAAGTCTTCCCGATACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004173
SLC7A4 MISSION shRNA shRNA Plasmid DNA
solute carrier family 7, member 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004173.1-334s1c1
Sequence:CCGGGCCCTATGCTATGCAGAATTTCTCGAGAAATTCTGCATAGCATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004173.1-1884s1c1
Sequence:CCGGCTCCACACACTACGTGGTATTCTCGAGAATACCACGTAGTGTGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004173.1-434s1c1
Sequence:CCGGGCTGGAATGTTCTCCTCGAATCTCGAGATTCGAGGAGAACATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004173.1-1816s1c1
Sequence:CCGGCTTGCAGTGTATTTCGGCTATCTCGAGATAGCCGAAATACACTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004173.1-1677s1c1
Sequence:CCGGGCAACAGTATCGGGAAGACTTCTCGAGAAGTCTTCCCGATACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004173
SLC7A4 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 7, member 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004173.1-334s1c1
Sequence:CCGGGCCCTATGCTATGCAGAATTTCTCGAGAAATTCTGCATAGCATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004173.1-1884s1c1
Sequence:CCGGCTCCACACACTACGTGGTATTCTCGAGAATACCACGTAGTGTGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004173.1-434s1c1
Sequence:CCGGGCTGGAATGTTCTCCTCGAATCTCGAGATTCGAGGAGAACATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004173.1-1816s1c1
Sequence:CCGGCTTGCAGTGTATTTCGGCTATCTCGAGATAGCCGAAATACACTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004173.1-1677s1c1
Sequence:CCGGGCAACAGTATCGGGAAGACTTCTCGAGAAGTCTTCCCGATACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks