EMAIL THIS PAGE TO A FRIEND

SLC7A5P2

solute carrier family 7 (amino acid transporter light chain, L system), member 5 pseudogene 2

Synonyms: IMAA MMAA
Species: Human SLC7A5P2(387254)
UniProtKB ID: Q9GIP4, Q6IPZ0, Q8MH62
Gene ID:
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199182 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199182 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199182 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_002594 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_002594 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00376221 predicted 769
2 SASI_Hs02_00376222 predicted 248
3 SASI_Hs02_00376223 predicted 1054
4 SASI_Hs02_00376224 predicted 959
5 SASI_Hs02_00376225 predicted 878
6 SASI_Hs02_00376226 predicted 764
7 SASI_Hs02_00376227 predicted 729
8 SASI_Hs02_00376228 predicted 966
9 SASI_Hs02_00376229 predicted 971
10 SASI_Hs02_00376230 predicted 768
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199182
SLC7A5P2 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 7 (amino acid transporter light chain, L system), member 5 pseudogene 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199182.1-611s1c1
Sequence:CCGGTCCGTGCAACTGATAGTGCATCTCGAGATGCACTATCAGTTGCACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199182.1-595s1c1
Sequence:CCGGGCTCGTAGCCTGCCACTCCGTCTCGAGACGGAGTGGCAGGCTACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199182.1-605s1c1
Sequence:CCGGTGCCACTCCGTGCAACTGATACTCGAGTATCAGTTGCACGGAGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199182.1-613s1c1
Sequence:CCGGCGTGCAACTGATAGTGCATCACTCGAGTGATGCACTATCAGTTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199182.1-475s1c1
Sequence:CCGGGCTCTGGATCGAGCTGCTCATCTCGAGATGAGCAGCTCGATCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199182
SLC7A5P2 MISSION shRNA shRNA Plasmid DNA
solute carrier family 7 (amino acid transporter light chain, L system), member 5 pseudogene 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199182.1-611s1c1
Sequence:CCGGTCCGTGCAACTGATAGTGCATCTCGAGATGCACTATCAGTTGCACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199182.1-595s1c1
Sequence:CCGGGCTCGTAGCCTGCCACTCCGTCTCGAGACGGAGTGGCAGGCTACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199182.1-605s1c1
Sequence:CCGGTGCCACTCCGTGCAACTGATACTCGAGTATCAGTTGCACGGAGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199182.1-613s1c1
Sequence:CCGGCGTGCAACTGATAGTGCATCACTCGAGTGATGCACTATCAGTTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199182.1-475s1c1
Sequence:CCGGGCTCTGGATCGAGCTGCTCATCTCGAGATGAGCAGCTCGATCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199182
SLC7A5P2 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 7 (amino acid transporter light chain, L system), member 5 pseudogene 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199182.1-611s1c1
Sequence:CCGGTCCGTGCAACTGATAGTGCATCTCGAGATGCACTATCAGTTGCACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199182.1-595s1c1
Sequence:CCGGGCTCGTAGCCTGCCACTCCGTCTCGAGACGGAGTGGCAGGCTACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199182.1-605s1c1
Sequence:CCGGTGCCACTCCGTGCAACTGATACTCGAGTATCAGTTGCACGGAGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199182.1-613s1c1
Sequence:CCGGCGTGCAACTGATAGTGCATCACTCGAGTGATGCACTATCAGTTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199182.1-475s1c1
Sequence:CCGGGCTCTGGATCGAGCTGCTCATCTCGAGATGAGCAGCTCGATCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks