EMAIL THIS PAGE TO A FRIEND

SLC7A8

solute carrier family 7 (amino acid transporter light chain, L system), member 8

Synonyms: LAT2 LPI-PC1
Gene ID:
Mouse(50934) solute carrier family 7 (cationic amino acid transporter, y+ system), member 8
Rat(84551) solute carrier family 7 (amino acid transporter light chain, L system), member 8
naked mole-rat(101717508) solute carrier family 7 (amino acid transporter light chain, L system), member 8
Domestic Rabbit(100009408) solute carrier family 7 (amino acid transporter light chain, L system), member 8
domestic guinea pig(100717482) solute carrier family 7 (amino acid transporter light chain, L system), member 8
cow(536818) solute carrier family 7 (amino acid transporter light chain, L system), member 8
Zebrafish(368665) solute carrier family 7 (cationic amino acid transporter, y+ system), member 8
domestic cat(101094106) solute carrier family 7 (amino acid transporter light chain, L system), member 8
dog(490608) solute carrier family 7 (amino acid transporter light chain, L system), member 8
129 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016972 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016972 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016972 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012244 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012244 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012244 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012244 Rosetta Predictions human pricing
NM_182728 Rosetta Predictions human pricing
NM_053442 Rosetta Predictions rat pricing
NM_016972 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012244 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090975 predicted 2116
2 SASI_Hs01_00090976 predicted 1641
3 SASI_Hs01_00090978 predicted 1452
4 SASI_Hs01_00090979 predicted 1466
5 SASI_Hs01_00090980 predicted 1707
6 SASI_Hs01_00090982 predicted 1872
7 SASI_Hs01_00090983 predicted 1571
8 SASI_Hs01_00090984 predicted 2100
9 SASI_Hs02_00343939 predicted 1691
10 SASI_Hs02_00343940 predicted 1702
11 SASI_Hs01_00090977 predicted 2147
12 SASI_Hs01_00090981 predicted 1780
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182728 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056284 predicted 1022
2 SASI_Hs01_00056285 predicted 552
3 SASI_Hs01_00056287 predicted 365
4 SASI_Hs01_00056288 predicted 368
5 SASI_Hs01_00056289 predicted 616
6 SASI_Hs01_00056291 predicted 777
7 SASI_Hs01_00056292 predicted 480
8 SASI_Hs01_00056293 predicted 1010
9 SASI_Hs02_00370886 predicted 606
10 SASI_Hs02_00370887 predicted 613
11 SASI_Hs01_00056286 predicted 1060
12 SASI_Hs01_00056290 predicted 687
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053442 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065695 predicted 821
2 SASI_Rn01_00065696 predicted 1440
3 SASI_Rn01_00065697 predicted 913
4 SASI_Rn01_00065698 predicted 1996
5 SASI_Rn01_00065699 predicted 2038
6 SASI_Rn01_00065700 predicted 1797
7 SASI_Rn01_00065701 predicted 753
8 SASI_Rn01_00065702 predicted 2029
9 SASI_Rn01_00065703 predicted 766
10 SASI_Rn01_00065704 predicted 2009
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016972 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200771 predicted 1398
2 SASI_Mm01_00200772 predicted 1946
3 SASI_Mm01_00200773 predicted 1166
4 SASI_Mm01_00200774 predicted 1525
5 SASI_Mm01_00200775 predicted 699
6 SASI_Mm01_00200776 predicted 1110
7 SASI_Mm01_00200777 predicted 1960
8 SASI_Mm01_00200778 predicted 1394
9 SASI_Mm01_00200779 predicted 1609
10 SASI_Mm02_00323821 predicted 852
11 SASI_Mm01_00200770 predicted 1209
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016972
SLC7A8 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 7 (amino acid transporter light chain, L system), member 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016972.2-3422s1c1
Sequence:CCGGGCACTGACTTTGGAGACCTTACTCGAGTAAGGTCTCCAAAGTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016972.2-661s1c1
Sequence:CCGGCCTGAAGAAAGAGATCGGATTCTCGAGAATCCGATCTCTTTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016972.2-856s1c1
Sequence:CCGGCCCTAAGTCTGGAGGTGATTACTCGAGTAATCACCTCCAGACTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016972.2-1452s1c1
Sequence:CCGGCCAATGCAGTTGCTGTGACTTCTCGAGAAGTCACAGCAACTGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016972.2-1916s1c1
Sequence:CCGGGCCATTATGCTGACAGGAGTTCTCGAGAACTCCTGTCAGCATAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016972
SLC7A8 MISSION shRNA shRNA Plasmid DNA
solute carrier family 7 (amino acid transporter light chain, L system), member 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016972.2-3422s1c1
Sequence:CCGGGCACTGACTTTGGAGACCTTACTCGAGTAAGGTCTCCAAAGTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016972.2-661s1c1
Sequence:CCGGCCTGAAGAAAGAGATCGGATTCTCGAGAATCCGATCTCTTTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016972.2-856s1c1
Sequence:CCGGCCCTAAGTCTGGAGGTGATTACTCGAGTAATCACCTCCAGACTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016972.2-1452s1c1
Sequence:CCGGCCAATGCAGTTGCTGTGACTTCTCGAGAAGTCACAGCAACTGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016972.2-1916s1c1
Sequence:CCGGGCCATTATGCTGACAGGAGTTCTCGAGAACTCCTGTCAGCATAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016972
SLC7A8 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 7 (amino acid transporter light chain, L system), member 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016972.2-3422s1c1
Sequence:CCGGGCACTGACTTTGGAGACCTTACTCGAGTAAGGTCTCCAAAGTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016972.2-661s1c1
Sequence:CCGGCCTGAAGAAAGAGATCGGATTCTCGAGAATCCGATCTCTTTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016972.2-856s1c1
Sequence:CCGGCCCTAAGTCTGGAGGTGATTACTCGAGTAATCACCTCCAGACTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016972.2-1452s1c1
Sequence:CCGGCCAATGCAGTTGCTGTGACTTCTCGAGAAGTCACAGCAACTGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016972.2-1916s1c1
Sequence:CCGGGCCATTATGCTGACAGGAGTTCTCGAGAACTCCTGTCAGCATAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012244
SLC7A8 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 7 (amino acid transporter light chain, L system), member 8
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012244.2-2142s1c1
Sequence:CCGGGCCCAAGTGTTTCAGTGACTTCTCGAGAAGTCACTGAAACACTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012244.2-1390s1c1
Sequence:CCGGGCATTTGAGAATTTCCAGGAACTCGAGTTCCTGGAAATTCTCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012244.2-2107s1c1
Sequence:CCGGCCTGTCTATTTCCTGGGTGTTCTCGAGAACACCCAGGAAATAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012244.2-3950s1c1
Sequence:CCGGCCATCTTCTTATTCCCTCTTTCTCGAGAAAGAGGGAATAAGAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012244.2-946s1c1
Sequence:CCGGCTTGCTCTCATCGTCTGGATTCTCGAGAATCCAGACGATGAGAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012244
SLC7A8 MISSION shRNA shRNA Plasmid DNA
solute carrier family 7 (amino acid transporter light chain, L system), member 8
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012244.2-2142s1c1
Sequence:CCGGGCCCAAGTGTTTCAGTGACTTCTCGAGAAGTCACTGAAACACTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012244.2-1390s1c1
Sequence:CCGGGCATTTGAGAATTTCCAGGAACTCGAGTTCCTGGAAATTCTCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012244.2-2107s1c1
Sequence:CCGGCCTGTCTATTTCCTGGGTGTTCTCGAGAACACCCAGGAAATAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012244.2-3950s1c1
Sequence:CCGGCCATCTTCTTATTCCCTCTTTCTCGAGAAAGAGGGAATAAGAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012244.2-946s1c1
Sequence:CCGGCTTGCTCTCATCGTCTGGATTCTCGAGAATCCAGACGATGAGAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012244
SLC7A8 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 7 (amino acid transporter light chain, L system), member 8
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012244.2-2142s1c1
Sequence:CCGGGCCCAAGTGTTTCAGTGACTTCTCGAGAAGTCACTGAAACACTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012244.2-1390s1c1
Sequence:CCGGGCATTTGAGAATTTCCAGGAACTCGAGTTCCTGGAAATTCTCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012244.2-2107s1c1
Sequence:CCGGCCTGTCTATTTCCTGGGTGTTCTCGAGAACACCCAGGAAATAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012244.2-3950s1c1
Sequence:CCGGCCATCTTCTTATTCCCTCTTTCTCGAGAAAGAGGGAATAAGAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012244.2-946s1c1
Sequence:CCGGCTTGCTCTCATCGTCTGGATTCTCGAGAATCCAGACGATGAGAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks