EMAIL THIS PAGE TO A FRIEND

SLC8A2

solute carrier family 8 (sodium/calcium exchanger), member 2

Synonyms: NCX2
UniProtKB ID: Q9UPR5, B4DYQ9
Gene ID:
Mouse(110891) solute carrier family 8 (sodium/calcium exchanger), member 2
Rat(140447) solute carrier family 8 (sodium/calcium exchanger), member 2
domestic cat(101097856) solute carrier family 8 (sodium/calcium exchanger), member 2
dog(484420) solute carrier family 8 (sodium/calcium exchanger), member 2
cow(535881) solute carrier family 8 (sodium/calcium exchanger), member 2
sheep(101102171) solute carrier family 8 (sodium/calcium exchanger), member 2
domestic guinea pig(100729052) solute carrier family 8 (sodium/calcium exchanger), member 2
naked mole-rat(101708998) solute carrier family 8 (sodium/calcium exchanger), member 2
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_375633 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_375633 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_375633 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_148946 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_148946 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_148946 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU006051 MISSION® esiRNA esiRNA targeting mouse Slc8a2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015063 Rosetta Predictions human pricing
NM_078619 Rosetta Predictions rat pricing
NM_148946 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015063 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016415 predicted 1869
2 SASI_Hs01_00016416 predicted 715
3 SASI_Hs02_00346919 predicted 1857
4 SASI_Hs01_00016418 predicted 2920
5 SASI_Hs01_00016419 predicted 1292
6 SASI_Hs01_00016420 predicted 2433
7 SASI_Hs01_00016421 predicted 2677
8 SASI_Hs01_00016422 predicted 376
9 SASI_Hs01_00016423 predicted 2131
10 SASI_Hs01_00016424 predicted 472
11 SASI_Hs01_00016417 predicted 2702
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_078619 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108587 predicted 505
2 SASI_Rn01_00108588 predicted 973
3 SASI_Rn01_00108589 predicted 254
4 SASI_Rn01_00108590 predicted 1985
5 SASI_Rn01_00108591 predicted 2157
6 SASI_Rn01_00108592 predicted 946
7 SASI_Rn02_00267195 predicted 579
8 SASI_Rn01_00108593 predicted 366
9 SASI_Rn01_00108594 predicted 2009
10 SASI_Rn01_00108595 predicted 2064
11 SASI_Rn01_00108596 predicted 954
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148946 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021854 predicted 397
2 SASI_Mm01_00021855 predicted 1114
3 SASI_Mm01_00021856 predicted 1229
4 SASI_Mm01_00021857 predicted 376
5 SASI_Mm01_00021858 predicted 832
6 SASI_Mm01_00021859 predicted 1212
7 SASI_Mm01_00021861 predicted 1886
8 SASI_Mm01_00021862 predicted 561
9 SASI_Mm01_00021863 predicted 2474
10 SASI_Mm02_00342770 predicted 1900
11 SASI_Mm01_00021860 predicted 663
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_375633
SLC8A2 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 8 (sodium/calcium exchanger), member 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000054063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375633.1-2174s1c1
Sequence:CCGGCCTTGGTAATTGGGACCCATTCTCGAGAATGGGTCCCAATTACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375633.1-754s1c1
Sequence:CCGGGTCTGGCTTTATCTCATCCTTCTCGAGAAGGATGAGATAAAGCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375633.1-2469s1c1
Sequence:CCGGCTCTGTCAATGCTGTTGTCTTCTCGAGAAGACAACAGCATTGACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375633.1-2143s1c1
Sequence:CCGGGTGGATAAACTCATCAAGAAACTCGAGTTTCTTGATGAGTTTATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_375633
SLC8A2 MISSION shRNA shRNA Plasmid DNA
solute carrier family 8 (sodium/calcium exchanger), member 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000054063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375633.1-2174s1c1
Sequence:CCGGCCTTGGTAATTGGGACCCATTCTCGAGAATGGGTCCCAATTACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375633.1-754s1c1
Sequence:CCGGGTCTGGCTTTATCTCATCCTTCTCGAGAAGGATGAGATAAAGCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375633.1-2469s1c1
Sequence:CCGGCTCTGTCAATGCTGTTGTCTTCTCGAGAAGACAACAGCATTGACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375633.1-2143s1c1
Sequence:CCGGGTGGATAAACTCATCAAGAAACTCGAGTTTCTTGATGAGTTTATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_375633
SLC8A2 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 8 (sodium/calcium exchanger), member 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000054063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375633.1-2174s1c1
Sequence:CCGGCCTTGGTAATTGGGACCCATTCTCGAGAATGGGTCCCAATTACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375633.1-754s1c1
Sequence:CCGGGTCTGGCTTTATCTCATCCTTCTCGAGAAGGATGAGATAAAGCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375633.1-2469s1c1
Sequence:CCGGCTCTGTCAATGCTGTTGTCTTCTCGAGAAGACAACAGCATTGACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375633.1-2143s1c1
Sequence:CCGGGTGGATAAACTCATCAAGAAACTCGAGTTTCTTGATGAGTTTATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148946
SLC8A2 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 8 (sodium/calcium exchanger), member 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148946.2-2127s1c1
Sequence:CCGGCGAGGAGTCTTATGACTTTAACTCGAGTTAAAGTCATAAGACTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_148946.2-3091s1c1
Sequence:CCGGGCCCATCCTTTGTGAGGTAAACTCGAGTTTACCTCACAAAGGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148946.2-2008s1c1
Sequence:CCGGCTGCTACTCAACCAAGGGAATCTCGAGATTCCCTTGGTTGAGTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148946.2-408s1c1
Sequence:CCGGCGATCGATTTATGGCATCCATCTCGAGATGGATGCCATAAATCGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148946.2-1912s1c1
Sequence:CCGGCAGGTCAAGATAGTGGATGATCTCGAGATCATCCACTATCTTGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148946.2-3373s21c1
Sequence:CCGGACGCACCTTCCCTGATTTATCCTCGAGGATAAATCAGGGAAGGTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148946.2-1450s21c1
Sequence:CCGGGCAAAGGCAGGCTCCGATTATCTCGAGATAATCGGAGCCTGCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148946.2-2152s21c1
Sequence:CCGGACGGTGGATAAACTCATAAAGCTCGAGCTTTATGAGTTTATCCACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148946
SLC8A2 MISSION shRNA shRNA Plasmid DNA
solute carrier family 8 (sodium/calcium exchanger), member 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148946.2-2127s1c1
Sequence:CCGGCGAGGAGTCTTATGACTTTAACTCGAGTTAAAGTCATAAGACTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_148946.2-3091s1c1
Sequence:CCGGGCCCATCCTTTGTGAGGTAAACTCGAGTTTACCTCACAAAGGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148946.2-2008s1c1
Sequence:CCGGCTGCTACTCAACCAAGGGAATCTCGAGATTCCCTTGGTTGAGTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148946.2-408s1c1
Sequence:CCGGCGATCGATTTATGGCATCCATCTCGAGATGGATGCCATAAATCGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148946.2-1912s1c1
Sequence:CCGGCAGGTCAAGATAGTGGATGATCTCGAGATCATCCACTATCTTGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148946.2-3373s21c1
Sequence:CCGGACGCACCTTCCCTGATTTATCCTCGAGGATAAATCAGGGAAGGTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148946.2-1450s21c1
Sequence:CCGGGCAAAGGCAGGCTCCGATTATCTCGAGATAATCGGAGCCTGCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148946.2-2152s21c1
Sequence:CCGGACGGTGGATAAACTCATAAAGCTCGAGCTTTATGAGTTTATCCACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148946
SLC8A2 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 8 (sodium/calcium exchanger), member 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148946.2-2127s1c1
Sequence:CCGGCGAGGAGTCTTATGACTTTAACTCGAGTTAAAGTCATAAGACTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_148946.2-3091s1c1
Sequence:CCGGGCCCATCCTTTGTGAGGTAAACTCGAGTTTACCTCACAAAGGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148946.2-2008s1c1
Sequence:CCGGCTGCTACTCAACCAAGGGAATCTCGAGATTCCCTTGGTTGAGTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148946.2-408s1c1
Sequence:CCGGCGATCGATTTATGGCATCCATCTCGAGATGGATGCCATAAATCGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148946.2-1912s1c1
Sequence:CCGGCAGGTCAAGATAGTGGATGATCTCGAGATCATCCACTATCTTGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148946.2-3373s21c1
Sequence:CCGGACGCACCTTCCCTGATTTATCCTCGAGGATAAATCAGGGAAGGTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148946.2-1450s21c1
Sequence:CCGGGCAAAGGCAGGCTCCGATTATCTCGAGATAATCGGAGCCTGCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148946.2-2152s21c1
Sequence:CCGGACGGTGGATAAACTCATAAAGCTCGAGCTTTATGAGTTTATCCACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks