EMAIL THIS PAGE TO A FRIEND

SLC9B1

solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1

Synonyms: NHA1 NHEDC1
Gene ID:
Human(150159) Summary: The protein encoded by this gene is a sodium/hydrogen exchanger and transmembrane protein. Highly conserved orthologs of this gene have been found in other mammalian species. The expression of this gene may be limited to testis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
Mouse(74446) solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1
Rat(365946) solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1
domestic cat(101085373) solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1
dog(478496) solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1
sheep(101106685) solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1
naked mole-rat(101725249) solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1
domestic guinea pig(100731457) solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028946 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028946 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028946 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_139173 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139173 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139173 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU116641 MISSION® esiRNA esiRNA human NHEDC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100874 Rosetta Predictions human pricing
NM_139173 Rosetta Predictions human pricing
XM_001077752 Rosetta Predictions rat pricing
XM_345293 Rosetta Predictions rat pricing
NM_028946 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100874 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322417 predicted 326
2 SASI_Hs02_00322418 predicted 301
3 SASI_Hs02_00322419 predicted 1104
4 SASI_Hs02_00322420 predicted 594
5 SASI_Hs02_00322421 predicted 320
6 SASI_Hs02_00322422 predicted 341
7 SASI_Hs02_00322423 predicted 500
8 SASI_Hs02_00322424 predicted 1125
9 SASI_Hs02_00322425 predicted 532
10 SASI_Hs02_00322426 predicted 328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139173 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227369 predicted 335
2 SASI_Hs01_00227370 predicted 299
3 SASI_Hs02_00364204 predicted 1111
4 SASI_Hs02_00364205 predicted 599
5 SASI_Hs01_00227371 predicted 320
6 SASI_Hs01_00227372 predicted 339
7 SASI_Hs02_00364206 predicted 502
8 SASI_Hs02_00364207 predicted 1123
9 SASI_Hs02_00364208 predicted 525
10 SASI_Hs01_00227374 predicted 332
11 SASI_Hs01_00227373 predicted 493
12 SASI_Hs01_00227375 predicted 295
13 SASI_Hs01_00227376 predicted 458
14 SASI_Hs01_00227377 predicted 385
15 SASI_Hs01_00227378 predicted 799
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077752 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00358371 predicted 1023
2 SASI_Rn02_00358372 predicted 239
3 SASI_Rn02_00358373 predicted 420
4 SASI_Rn02_00358374 predicted 1273
5 SASI_Rn02_00358375 predicted 240
6 SASI_Rn02_00358376 predicted 820
7 SASI_Rn02_00358377 predicted 520
8 SASI_Rn02_00358378 predicted 459
9 SASI_Rn02_00358379 predicted 1318
10 SASI_Rn02_00358380 predicted 244
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345293 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398174 predicted 879
2 SASI_Rn02_00398175 predicted 819
3 SASI_Rn02_00398176 predicted 728
4 SASI_Rn02_00398177 predicted 826
5 SASI_Rn02_00398178 predicted 852
6 SASI_Rn02_00398179 predicted 723
7 SASI_Rn02_00398180 predicted 763
8 SASI_Rn02_00398181 predicted 746
9 SASI_Rn02_00398182 predicted 859
10 SASI_Rn02_00398183 predicted 735
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028946 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334663 predicted 1967
2 SASI_Mm02_00334664 predicted 1747
3 SASI_Mm02_00334665 predicted 1684
4 SASI_Mm01_00190011 predicted 1164
5 SASI_Mm01_00190012 predicted 1480
6 SASI_Mm01_00190013 predicted 1466
7 SASI_Mm01_00190015 predicted 1059
8 SASI_Mm01_00190020 predicted 1050
9 SASI_Mm02_00334666 predicted 1839
10 SASI_Mm02_00334667 predicted 1510
11 SASI_Mm01_00190014 predicted 1786
12 SASI_Mm01_00190016 predicted 1461
13 SASI_Mm01_00190017 predicted 1135
14 SASI_Mm01_00190018 predicted 1064
15 SASI_Mm01_00190019 predicted 1057
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028946
VALIDATED
SLC9B1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127079    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028946.1-1730s1c1
Sequence:CCGGCCACCATCATCACATTCATTTCTCGAGAAATGAATGTGATGATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028946.1-1031s1c1
Sequence:CCGGCCACCTCTCATTGGGATGTTACTCGAGTAACATCCCAATGAGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028946.1-563s1c1
Sequence:CCGGGTAACTGTTGAGATGTCCAAACTCGAGTTTGGACATCTCAACAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028946.1-1065s1c1
Sequence:CCGGCCATCAGGAATGTTCCGATTACTCGAGTAATCGGAACATTCCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028946.1-1139s1c1
Sequence:CCGGGCCCTTACTATTATCCTAGTACTCGAGTACTAGGATAATAGTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028946.3-1159s21c1
Sequence:CCGGGCCCTTACTATTATCCTAGTACTCGAGTACTAGGATAATAGTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028946.3-1085s21c1
Sequence:CCGGCCATCAGGAATGTTCCGATTACTCGAGTAATCGGAACATTCCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028946.3-1901s21c1
Sequence:CCGGTGGCACTATCTGTTCGAATTTCTCGAGAAATTCGAACAGATAGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028946.3-916s21c1
Sequence:CCGGACTCTACTCTGGGCCCTTATACTCGAGTATAAGGGCCCAGAGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028946.3-583s21c1
Sequence:CCGGGTAACTGTTGAGATGTCCAAACTCGAGTTTGGACATCTCAACAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028946
VALIDATED
SLC9B1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127079    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028946.1-1730s1c1
Sequence:CCGGCCACCATCATCACATTCATTTCTCGAGAAATGAATGTGATGATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028946.1-1031s1c1
Sequence:CCGGCCACCTCTCATTGGGATGTTACTCGAGTAACATCCCAATGAGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028946.1-563s1c1
Sequence:CCGGGTAACTGTTGAGATGTCCAAACTCGAGTTTGGACATCTCAACAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028946.1-1065s1c1
Sequence:CCGGCCATCAGGAATGTTCCGATTACTCGAGTAATCGGAACATTCCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028946.1-1139s1c1
Sequence:CCGGGCCCTTACTATTATCCTAGTACTCGAGTACTAGGATAATAGTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028946.3-1159s21c1
Sequence:CCGGGCCCTTACTATTATCCTAGTACTCGAGTACTAGGATAATAGTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028946.3-1085s21c1
Sequence:CCGGCCATCAGGAATGTTCCGATTACTCGAGTAATCGGAACATTCCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028946.3-1901s21c1
Sequence:CCGGTGGCACTATCTGTTCGAATTTCTCGAGAAATTCGAACAGATAGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028946.3-916s21c1
Sequence:CCGGACTCTACTCTGGGCCCTTATACTCGAGTATAAGGGCCCAGAGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028946.3-583s21c1
Sequence:CCGGGTAACTGTTGAGATGTCCAAACTCGAGTTTGGACATCTCAACAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028946
VALIDATED
SLC9B1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127079    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028946.1-1730s1c1
Sequence:CCGGCCACCATCATCACATTCATTTCTCGAGAAATGAATGTGATGATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028946.1-1031s1c1
Sequence:CCGGCCACCTCTCATTGGGATGTTACTCGAGTAACATCCCAATGAGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028946.1-563s1c1
Sequence:CCGGGTAACTGTTGAGATGTCCAAACTCGAGTTTGGACATCTCAACAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028946.1-1065s1c1
Sequence:CCGGCCATCAGGAATGTTCCGATTACTCGAGTAATCGGAACATTCCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028946.1-1139s1c1
Sequence:CCGGGCCCTTACTATTATCCTAGTACTCGAGTACTAGGATAATAGTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028946.3-1159s21c1
Sequence:CCGGGCCCTTACTATTATCCTAGTACTCGAGTACTAGGATAATAGTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028946.3-1085s21c1
Sequence:CCGGCCATCAGGAATGTTCCGATTACTCGAGTAATCGGAACATTCCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028946.3-1901s21c1
Sequence:CCGGTGGCACTATCTGTTCGAATTTCTCGAGAAATTCGAACAGATAGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028946.3-916s21c1
Sequence:CCGGACTCTACTCTGGGCCCTTATACTCGAGTATAAGGGCCCAGAGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028946.3-583s21c1
Sequence:CCGGGTAACTGTTGAGATGTCCAAACTCGAGTTTGGACATCTCAACAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139173
SLC9B1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139173.1-365s1c1
Sequence:CCGGCTGGTCAATCTTAGGCTCTGACTCGAGTCAGAGCCTAAGATTGACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139173.1-189s1c1
Sequence:CCGGCAGAGTCTCATTGATCCTAATCTCGAGATTAGGATCAATGAGACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139173.1-656s1c1
Sequence:CCGGGCATTTGAAGGTCGTTTGTTTCTCGAGAAACAAACGACCTTCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139173.1-600s1c1
Sequence:CCGGGCCCTTACCATTATTCTAATACTCGAGTATTAGAATAATGGTAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139173.1-662s1c1
Sequence:CCGGGAAGGTCGTTTGTTTCAGATTCTCGAGAATCTGAAACAAACGACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139173.1-537s1c1
Sequence:CCGGGTTCCATTCATCAATGAACATCTCGAGATGTTCATTGATGAATGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139173.1-279s1c1
Sequence:CCGGGAGACATACATTTCTTGTCCTCTCGAGAGGACAAGAAATGTATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139173.1-567s1c1
Sequence:CCGGCCTAACACATGGTCTTCAATTCTCGAGAATTGAAGACCATGTGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139173.1-204s1c1
Sequence:CCGGCCTAATAATACTGCACATGAACTCGAGTTCATGTGCAGTATTATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139173.1-751s1c1
Sequence:CCGGCCTGGCAATGGGCATTTCTATCTCGAGATAGAAATGCCCATTGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139173.1-492s1c1
Sequence:CCGGCCACCTCTTCTTGGGATGTTACTCGAGTAACATCCCAAGAAGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139173
SLC9B1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139173.1-365s1c1
Sequence:CCGGCTGGTCAATCTTAGGCTCTGACTCGAGTCAGAGCCTAAGATTGACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139173.1-189s1c1
Sequence:CCGGCAGAGTCTCATTGATCCTAATCTCGAGATTAGGATCAATGAGACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139173.1-656s1c1
Sequence:CCGGGCATTTGAAGGTCGTTTGTTTCTCGAGAAACAAACGACCTTCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139173.1-600s1c1
Sequence:CCGGGCCCTTACCATTATTCTAATACTCGAGTATTAGAATAATGGTAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139173.1-662s1c1
Sequence:CCGGGAAGGTCGTTTGTTTCAGATTCTCGAGAATCTGAAACAAACGACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139173.1-537s1c1
Sequence:CCGGGTTCCATTCATCAATGAACATCTCGAGATGTTCATTGATGAATGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139173.1-279s1c1
Sequence:CCGGGAGACATACATTTCTTGTCCTCTCGAGAGGACAAGAAATGTATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139173.1-567s1c1
Sequence:CCGGCCTAACACATGGTCTTCAATTCTCGAGAATTGAAGACCATGTGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139173.1-204s1c1
Sequence:CCGGCCTAATAATACTGCACATGAACTCGAGTTCATGTGCAGTATTATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139173.1-751s1c1
Sequence:CCGGCCTGGCAATGGGCATTTCTATCTCGAGATAGAAATGCCCATTGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139173.1-492s1c1
Sequence:CCGGCCACCTCTTCTTGGGATGTTACTCGAGTAACATCCCAAGAAGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139173
SLC9B1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139173.1-365s1c1
Sequence:CCGGCTGGTCAATCTTAGGCTCTGACTCGAGTCAGAGCCTAAGATTGACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139173.1-189s1c1
Sequence:CCGGCAGAGTCTCATTGATCCTAATCTCGAGATTAGGATCAATGAGACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139173.1-656s1c1
Sequence:CCGGGCATTTGAAGGTCGTTTGTTTCTCGAGAAACAAACGACCTTCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139173.1-600s1c1
Sequence:CCGGGCCCTTACCATTATTCTAATACTCGAGTATTAGAATAATGGTAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139173.1-662s1c1
Sequence:CCGGGAAGGTCGTTTGTTTCAGATTCTCGAGAATCTGAAACAAACGACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139173.1-537s1c1
Sequence:CCGGGTTCCATTCATCAATGAACATCTCGAGATGTTCATTGATGAATGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139173.1-279s1c1
Sequence:CCGGGAGACATACATTTCTTGTCCTCTCGAGAGGACAAGAAATGTATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139173.1-567s1c1
Sequence:CCGGCCTAACACATGGTCTTCAATTCTCGAGAATTGAAGACCATGTGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139173.1-204s1c1
Sequence:CCGGCCTAATAATACTGCACATGAACTCGAGTTCATGTGCAGTATTATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139173.1-751s1c1
Sequence:CCGGCCTGGCAATGGGCATTTCTATCTCGAGATAGAAATGCCCATTGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139173.1-492s1c1
Sequence:CCGGCCACCTCTTCTTGGGATGTTACTCGAGTAACATCCCAAGAAGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks