EMAIL THIS PAGE TO A FRIEND

SLC9C1

solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1

Synonyms: NHE SLC9A10 sperm-NHE
UniProtKB ID: Q4G0N8, Q6ZRP4, Q7RTP2
Gene ID:
Human(285335) Summary: SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]
Mouse(208169) solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Rat(288117) solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
sheep(101114487) solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
naked mole-rat(101699738) solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
domestic guinea pig(100718234) solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
dog(478563) solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
domestic cat(101095603) solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2106664 Anti-SLC9A10 antibody produced in rabbit affinity isolated antibody rabbit, human, rat, guinea pig
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_210562 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_210562 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_210562 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198106 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198106 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198106 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU019151 MISSION® esiRNA esiRNA targeting human SLC9A10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_183061 Rosetta Predictions human pricing
NM_001008762 Rosetta Predictions rat pricing
XM_579210 Rosetta Predictions rat pricing
NM_198106 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183061 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011256 predicted 2562
2 SASI_Hs01_00011257 predicted 1618
3 SASI_Hs02_00371218 predicted 2494
4 SASI_Hs01_00011258 predicted 1479
5 SASI_Hs01_00011259 predicted 1654
6 SASI_Hs01_00011260 predicted 2261
7 SASI_Hs01_00011261 predicted 2255
8 SASI_Hs01_00011262 predicted 708
9 SASI_Hs01_00011263 predicted 3377
10 SASI_Hs01_00011264 predicted 3284
11 SASI_Hs01_00011265 predicted 492
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008762 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035401 predicted 905
2 SASI_Rn01_00035402 predicted 1748
3 SASI_Rn01_00035403 predicted 1846
4 SASI_Rn01_00035404 predicted 1598
5 SASI_Rn01_00035405 predicted 1586
6 SASI_Rn01_00035406 predicted 1922
7 SASI_Rn01_00035407 predicted 1382
8 SASI_Rn01_00035408 predicted 1870
9 SASI_Rn01_00035409 predicted 979
10 SASI_Rn01_00035410 predicted 758
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579210 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00142281 predicted 906
2 SASI_Rn01_00142282 predicted 1756
3 SASI_Rn01_00142283 predicted 1844
4 SASI_Rn01_00142284 predicted 1591
5 SASI_Rn01_00142285 predicted 1590
6 SASI_Rn01_00142286 predicted 1925
7 SASI_Rn01_00142287 predicted 1381
8 SASI_Rn01_00142288 predicted 1876
9 SASI_Rn01_00142289 predicted 986
10 SASI_Rn01_00142290 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198106 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061028 predicted 2616
2 SASI_Mm01_00061029 predicted 1967
3 SASI_Mm01_00061030 predicted 2583
4 SASI_Mm01_00061032 predicted 851
5 SASI_Mm01_00061034 predicted 581
6 SASI_Mm01_00061035 predicted 2446
7 SASI_Mm02_00350833 predicted 1450
8 SASI_Mm01_00061036 predicted 3351
9 SASI_Mm02_00350834 predicted 2099
10 SASI_Mm01_00061037 predicted 1455
11 SASI_Mm01_00061031 predicted 2290
12 SASI_Mm01_00061033 predicted 2294
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_210562
SLC9C1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210562.4-2522s1c1
Sequence:CCGGGCAGACATAATGACCATAATTCTCGAGAATTATGGTCATTATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210562.4-3065s1c1
Sequence:CCGGCCGATAATTGACACAGACTATCTCGAGATAGTCTGTGTCAATTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210562.4-3752s1c1
Sequence:CCGGCCTAGAATAAACCTAAGGAAACTCGAGTTTCCTTAGGTTTATTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210562.4-658s1c1
Sequence:CCGGGCCTACCCAATGGTTATTATTCTCGAGAATAATAACCATTGGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210562.4-1742s1c1
Sequence:CCGGCCACACTGTAACAAGGAAATACTCGAGTATTTCCTTGTTACAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_210562
SLC9C1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210562.4-2522s1c1
Sequence:CCGGGCAGACATAATGACCATAATTCTCGAGAATTATGGTCATTATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210562.4-3065s1c1
Sequence:CCGGCCGATAATTGACACAGACTATCTCGAGATAGTCTGTGTCAATTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210562.4-3752s1c1
Sequence:CCGGCCTAGAATAAACCTAAGGAAACTCGAGTTTCCTTAGGTTTATTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210562.4-658s1c1
Sequence:CCGGGCCTACCCAATGGTTATTATTCTCGAGAATAATAACCATTGGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210562.4-1742s1c1
Sequence:CCGGCCACACTGTAACAAGGAAATACTCGAGTATTTCCTTGTTACAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_210562
SLC9C1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210562.4-2522s1c1
Sequence:CCGGGCAGACATAATGACCATAATTCTCGAGAATTATGGTCATTATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210562.4-3065s1c1
Sequence:CCGGCCGATAATTGACACAGACTATCTCGAGATAGTCTGTGTCAATTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210562.4-3752s1c1
Sequence:CCGGCCTAGAATAAACCTAAGGAAACTCGAGTTTCCTTAGGTTTATTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210562.4-658s1c1
Sequence:CCGGGCCTACCCAATGGTTATTATTCTCGAGAATAATAACCATTGGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210562.4-1742s1c1
Sequence:CCGGCCACACTGTAACAAGGAAATACTCGAGTATTTCCTTGTTACAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198106
SLC9C1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198106.1-2790s1c1
Sequence:CCGGGCAGTCTGTTATCCAGCCATTCTCGAGAATGGCTGGATAACAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198106.1-1495s1c1
Sequence:CCGGGCAGTTACTAAACTAGGTCTTCTCGAGAAGACCTAGTTTAGTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198106.1-1489s1c1
Sequence:CCGGCCAATGGCAGTTACTAAACTACTCGAGTAGTTTAGTAACTGCCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198106.1-2863s1c1
Sequence:CCGGGCCATAACCTTTATTCAGGAACTCGAGTTCCTGAATAAAGGTTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198106.1-770s1c1
Sequence:CCGGCCTCAGTGTTATCCTTAGTTACTCGAGTAACTAAGGATAACACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198106
SLC9C1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198106.1-2790s1c1
Sequence:CCGGGCAGTCTGTTATCCAGCCATTCTCGAGAATGGCTGGATAACAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198106.1-1495s1c1
Sequence:CCGGGCAGTTACTAAACTAGGTCTTCTCGAGAAGACCTAGTTTAGTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198106.1-1489s1c1
Sequence:CCGGCCAATGGCAGTTACTAAACTACTCGAGTAGTTTAGTAACTGCCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198106.1-2863s1c1
Sequence:CCGGGCCATAACCTTTATTCAGGAACTCGAGTTCCTGAATAAAGGTTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198106.1-770s1c1
Sequence:CCGGCCTCAGTGTTATCCTTAGTTACTCGAGTAACTAAGGATAACACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198106
SLC9C1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198106.1-2790s1c1
Sequence:CCGGGCAGTCTGTTATCCAGCCATTCTCGAGAATGGCTGGATAACAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198106.1-1495s1c1
Sequence:CCGGGCAGTTACTAAACTAGGTCTTCTCGAGAAGACCTAGTTTAGTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198106.1-1489s1c1
Sequence:CCGGCCAATGGCAGTTACTAAACTACTCGAGTAGTTTAGTAACTGCCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198106.1-2863s1c1
Sequence:CCGGGCCATAACCTTTATTCAGGAACTCGAGTTCCTGAATAAAGGTTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198106.1-770s1c1
Sequence:CCGGCCTCAGTGTTATCCTTAGTTACTCGAGTAACTAAGGATAACACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks