EMAIL THIS PAGE TO A FRIEND

SLC9C2

solute carrier family 9, member C2 (putative)

Synonyms: RP3-436N22.2 SLC9A11
UniProtKB ID: Q5TAH2, Q86UF3
Gene ID:
Rat(364029) solute carrier family 9, member C2 (putative)
dog(480068) solute carrier family 9, member C2 (putative)
domestic cat(101092983) solute carrier family 9, member C2 (putative)
domestic guinea pig(100731587) solute carrier family 9, member C2 (putative)
naked mole-rat(101696404) solute carrier family 9, member C2 (putative)
cow(787966) solute carrier family 9, member C2 (putative)
sheep(101116333) solute carrier family 9, member C2 (putative)
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178527 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178527 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178527 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU049481 MISSION® esiRNA esiRNA human SLC9A11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178527 Rosetta Predictions human pricing
XM_001074135 Rosetta Predictions rat pricing
XM_344165 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178527 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139769 predicted 1251
2 SASI_Hs02_00369771 predicted 2188
3 SASI_Hs01_00139770 predicted 3464
4 SASI_Hs01_00139771 predicted 3789
5 SASI_Hs01_00139772 predicted 1682
6 SASI_Hs01_00139773 predicted 3342
7 SASI_Hs01_00139774 predicted 2717
8 SASI_Hs01_00139775 predicted 576
9 SASI_Hs01_00139776 predicted 3683
10 SASI_Hs01_00139777 predicted 3442
11 SASI_Hs01_00139778 predicted 1349
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074135 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00345143 predicted 2879
2 SASI_Rn02_00345144 predicted 686
3 SASI_Rn02_00345145 predicted 2297
4 SASI_Rn02_00345146 predicted 1907
5 SASI_Rn02_00345147 predicted 1120
6 SASI_Rn02_00345148 predicted 1143
7 SASI_Rn02_00345149 predicted 2371
8 SASI_Rn02_00345150 predicted 2444
9 SASI_Rn02_00345151 predicted 1417
10 SASI_Rn02_00345152 predicted 620
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344165 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396896 predicted 2879
2 SASI_Rn02_00396897 predicted 2722
3 SASI_Rn02_00396898 predicted 3106
4 SASI_Rn02_00396899 predicted 2874
5 SASI_Rn02_00396900 predicted 3081
6 SASI_Rn02_00396901 predicted 3013
7 SASI_Rn02_00396902 predicted 2748
8 SASI_Rn02_00396903 predicted 3109
9 SASI_Rn02_00396904 predicted 3101
10 SASI_Rn02_00396905 predicted 2869
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178527
SLC9C2 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 9, member C2 (putative)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178527.2-2833s1c1
Sequence:CCGGCCTTTGTTCAAGAGGCATTATCTCGAGATAATGCCTCTTGAACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178527.2-543s1c1
Sequence:CCGGCGATTCTTTCTCTATCAGGATCTCGAGATCCTGATAGAGAAAGAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136146    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178527.2-3800s1c1
Sequence:CCGGGTCAGGTTAAAGACCAAACTACTCGAGTAGTTTGGTCTTTAACCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178527.2-3048s1c1
Sequence:CCGGCCATTTGTAAAGGAGGTGAAACTCGAGTTTCACCTCCTTTACAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178527.2-605s1c1
Sequence:CCGGCAAATTGTCTACCCTCTTCTACTCGAGTAGAAGAGGGTAGACAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178527.2-849s1c1
Sequence:CCGGGCATTATAGATCCTCTTCGTTCTCGAGAACGAAGAGGATCTATAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178527.2-1211s1c1
Sequence:CCGGGCTGTAGGACTGAATTTAGATCTCGAGATCTAAATTCAGTCCTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178527.2-1813s1c1
Sequence:CCGGGAGGATCGAATACATTCCTTTCTCGAGAAAGGAATGTATTCGATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178527.3-2309s21c1
Sequence:CCGGGGCCAATGGCAAGAGGTTTAACTCGAGTTAAACCTCTTGCCATTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178527
SLC9C2 MISSION shRNA shRNA Plasmid DNA
solute carrier family 9, member C2 (putative)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178527.2-2833s1c1
Sequence:CCGGCCTTTGTTCAAGAGGCATTATCTCGAGATAATGCCTCTTGAACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178527.2-543s1c1
Sequence:CCGGCGATTCTTTCTCTATCAGGATCTCGAGATCCTGATAGAGAAAGAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136146    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178527.2-3800s1c1
Sequence:CCGGGTCAGGTTAAAGACCAAACTACTCGAGTAGTTTGGTCTTTAACCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178527.2-3048s1c1
Sequence:CCGGCCATTTGTAAAGGAGGTGAAACTCGAGTTTCACCTCCTTTACAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178527.2-605s1c1
Sequence:CCGGCAAATTGTCTACCCTCTTCTACTCGAGTAGAAGAGGGTAGACAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178527.2-849s1c1
Sequence:CCGGGCATTATAGATCCTCTTCGTTCTCGAGAACGAAGAGGATCTATAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178527.2-1211s1c1
Sequence:CCGGGCTGTAGGACTGAATTTAGATCTCGAGATCTAAATTCAGTCCTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178527.2-1813s1c1
Sequence:CCGGGAGGATCGAATACATTCCTTTCTCGAGAAAGGAATGTATTCGATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178527.3-2309s21c1
Sequence:CCGGGGCCAATGGCAAGAGGTTTAACTCGAGTTAAACCTCTTGCCATTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178527
SLC9C2 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 9, member C2 (putative)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178527.2-2833s1c1
Sequence:CCGGCCTTTGTTCAAGAGGCATTATCTCGAGATAATGCCTCTTGAACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178527.2-543s1c1
Sequence:CCGGCGATTCTTTCTCTATCAGGATCTCGAGATCCTGATAGAGAAAGAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136146    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178527.2-3800s1c1
Sequence:CCGGGTCAGGTTAAAGACCAAACTACTCGAGTAGTTTGGTCTTTAACCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178527.2-3048s1c1
Sequence:CCGGCCATTTGTAAAGGAGGTGAAACTCGAGTTTCACCTCCTTTACAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178527.2-605s1c1
Sequence:CCGGCAAATTGTCTACCCTCTTCTACTCGAGTAGAAGAGGGTAGACAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178527.2-849s1c1
Sequence:CCGGGCATTATAGATCCTCTTCGTTCTCGAGAACGAAGAGGATCTATAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178527.2-1211s1c1
Sequence:CCGGGCTGTAGGACTGAATTTAGATCTCGAGATCTAAATTCAGTCCTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178527.2-1813s1c1
Sequence:CCGGGAGGATCGAATACATTCCTTTCTCGAGAAAGGAATGTATTCGATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178527.3-2309s21c1
Sequence:CCGGGGCCAATGGCAAGAGGTTTAACTCGAGTTAAACCTCTTGCCATTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks