EMAIL THIS PAGE TO A FRIEND

SLCO5A1

solute carrier organic anion transporter family, member 5A1

Synonyms: OATP-J OATP-RP4 OATP5A1 OATPRP4 SLC21A15
UniProtKB ID: Q9H2Y9, A4QPC2, B2RPF7, B3KMU7, E9PKK5, G3V1C0
Gene ID:
Human(81796) Summary: This gene encodes a 12 transmembrane domain protein that is a member of the solute carrier organic anion transporter superfamily. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]
Mouse(240726) solute carrier organic anion transporter family, member 5A1
Rat(312907) solute carrier organic anion transporter family, member 5A1
domestic guinea pig(100715288) solute carrier organic anion transporter family, member 5A1
naked mole-rat(101702036) solute carrier organic anion transporter family, member 5A1
cow(535202) solute carrier organic anion transporter family, member 5A1
sheep(101103733) solute carrier organic anion transporter family, member 5A1
Zebrafish(570033) solute carrier organic anion transporter family, member 5A1
dog(477907) solute carrier organic anion transporter family, member 5A1
Horse(100062585) solute carrier organic anion transporter family, member 5A1
domestic cat(101093833) solute carrier organic anion transporter family, member 5A1
chicken(420174) solute carrier organic anion transporter family, member 5A1
108 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172841 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172841 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172841 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030958 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030958 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030958 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030958 Rosetta Predictions human pricing
NM_001107898 Rosetta Predictions rat pricing
NM_172841 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030958 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192965 predicted 2848
2 SASI_Hs01_00192966 predicted 2719
3 SASI_Hs02_00358538 predicted 1074
4 SASI_Hs01_00192967 predicted 1065
5 SASI_Hs01_00192968 predicted 2271
6 SASI_Hs01_00192969 predicted 2366
7 SASI_Hs01_00192970 predicted 2972
8 SASI_Hs01_00192971 predicted 1036
9 SASI_Hs01_00192972 predicted 1031
10 SASI_Hs01_00192974 predicted 2615
11 SASI_Hs01_00192973 predicted 2217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107898 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233365 predicted 2995
2 SASI_Rn02_00233366 predicted 1317
3 SASI_Rn02_00233367 predicted 1436
4 SASI_Rn02_00233368 predicted 2710
5 SASI_Rn02_00233369 predicted 2822
6 SASI_Rn02_00233370 predicted 2855
7 SASI_Rn02_00233371 predicted 2245
8 SASI_Rn02_00233372 predicted 1078
9 SASI_Rn02_00233373 predicted 1106
10 SASI_Rn02_00233374 predicted 1647
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172841 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165614 predicted 1016
2 SASI_Mm01_00165615 predicted 1057
3 SASI_Mm02_00344772 predicted 2569
4 SASI_Mm01_00165616 predicted 2214
5 SASI_Mm02_00344773 predicted 1532
6 SASI_Mm01_00165617 predicted 1069
7 SASI_Mm01_00165618 predicted 1638
8 SASI_Mm02_00344774 predicted 2954
9 SASI_Mm01_00165619 predicted 2392
10 SASI_Mm01_00165620 predicted 1427
11 SASI_Mm01_00165621 predicted 1834
12 SASI_Mm01_00165622 predicted 2333
13 SASI_Mm01_00165623 predicted 2512
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172841
SLCO5A1 MISSION shRNA Bacterial Glycerol Stock
solute carrier organic anion transporter family, member 5A1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172841.1-1553s1c1
Sequence:CCGGCCTAGCCATCAAGTATGTCATCTCGAGATGACATACTTGATGGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172841.1-2398s1c1
Sequence:CCGGGCATTAACAGTGGTAATCTTACTCGAGTAAGATTACCACTGTTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172841.1-3610s1c1
Sequence:CCGGGCCCTCTAACAGCATGTTCTACTCGAGTAGAACATGCTGTTAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172841.1-2436s1c1
Sequence:CCGGCGCCCTACGTTGTTCTTCTATCTCGAGATAGAAGAACAACGTAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172841.1-1059s1c1
Sequence:CCGGCTGACTTTCATCCAGGCGTTACTCGAGTAACGCCTGGATGAAAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172841.2-3410s21c1
Sequence:CCGGTTAGCTAGATCTGTCGTTATGCTCGAGCATAACGACAGATCTAGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172841.2-2825s21c1
Sequence:CCGGGAGTACAACGTGACGTCATTTCTCGAGAAATGACGTCACGTTGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172841
SLCO5A1 MISSION shRNA shRNA Plasmid DNA
solute carrier organic anion transporter family, member 5A1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172841.1-1553s1c1
Sequence:CCGGCCTAGCCATCAAGTATGTCATCTCGAGATGACATACTTGATGGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172841.1-2398s1c1
Sequence:CCGGGCATTAACAGTGGTAATCTTACTCGAGTAAGATTACCACTGTTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172841.1-3610s1c1
Sequence:CCGGGCCCTCTAACAGCATGTTCTACTCGAGTAGAACATGCTGTTAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172841.1-2436s1c1
Sequence:CCGGCGCCCTACGTTGTTCTTCTATCTCGAGATAGAAGAACAACGTAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172841.1-1059s1c1
Sequence:CCGGCTGACTTTCATCCAGGCGTTACTCGAGTAACGCCTGGATGAAAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172841.2-3410s21c1
Sequence:CCGGTTAGCTAGATCTGTCGTTATGCTCGAGCATAACGACAGATCTAGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172841.2-2825s21c1
Sequence:CCGGGAGTACAACGTGACGTCATTTCTCGAGAAATGACGTCACGTTGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172841
SLCO5A1 MISSION shRNA Lentiviral Transduction Particles
solute carrier organic anion transporter family, member 5A1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172841.1-1553s1c1
Sequence:CCGGCCTAGCCATCAAGTATGTCATCTCGAGATGACATACTTGATGGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172841.1-2398s1c1
Sequence:CCGGGCATTAACAGTGGTAATCTTACTCGAGTAAGATTACCACTGTTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172841.1-3610s1c1
Sequence:CCGGGCCCTCTAACAGCATGTTCTACTCGAGTAGAACATGCTGTTAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172841.1-2436s1c1
Sequence:CCGGCGCCCTACGTTGTTCTTCTATCTCGAGATAGAAGAACAACGTAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172841.1-1059s1c1
Sequence:CCGGCTGACTTTCATCCAGGCGTTACTCGAGTAACGCCTGGATGAAAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172841.2-3410s21c1
Sequence:CCGGTTAGCTAGATCTGTCGTTATGCTCGAGCATAACGACAGATCTAGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172841.2-2825s21c1
Sequence:CCGGGAGTACAACGTGACGTCATTTCTCGAGAAATGACGTCACGTTGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030958
SLCO5A1 MISSION shRNA Bacterial Glycerol Stock
solute carrier organic anion transporter family, member 5A1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030958.1-2847s1c1
Sequence:CCGGGCCTCAAATTCGTTGGGTTTACTCGAGTAAACCCAACGAATTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030958.1-1705s1c1
Sequence:CCGGCCCAATGTTTACTTTCCCAAACTCGAGTTTGGGAAAGTAAACATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030958.1-3087s1c1
Sequence:CCGGCCTTCCCAGAAGCAATAAGTTCTCGAGAACTTATTGCTTCTGGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030958.1-2669s1c1
Sequence:CCGGGCACTGGGAATGCAGTTTGTTCTCGAGAACAAACTGCATTCCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030958.1-1472s1c1
Sequence:CCGGCCAACCTACTTAGATGACAATCTCGAGATTGTCATCTAAGTAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030958.2-3384s21c1
Sequence:CCGGCAGTATACACAGCCGCTATTCCTCGAGGAATAGCGGCTGTGTATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030958.2-1118s21c1
Sequence:CCGGGACCTTCATCCAGGCGTTAATCTCGAGATTAACGCCTGGATGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030958
SLCO5A1 MISSION shRNA shRNA Plasmid DNA
solute carrier organic anion transporter family, member 5A1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030958.1-2847s1c1
Sequence:CCGGGCCTCAAATTCGTTGGGTTTACTCGAGTAAACCCAACGAATTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030958.1-1705s1c1
Sequence:CCGGCCCAATGTTTACTTTCCCAAACTCGAGTTTGGGAAAGTAAACATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030958.1-3087s1c1
Sequence:CCGGCCTTCCCAGAAGCAATAAGTTCTCGAGAACTTATTGCTTCTGGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030958.1-2669s1c1
Sequence:CCGGGCACTGGGAATGCAGTTTGTTCTCGAGAACAAACTGCATTCCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030958.1-1472s1c1
Sequence:CCGGCCAACCTACTTAGATGACAATCTCGAGATTGTCATCTAAGTAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030958.2-3384s21c1
Sequence:CCGGCAGTATACACAGCCGCTATTCCTCGAGGAATAGCGGCTGTGTATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030958.2-1118s21c1
Sequence:CCGGGACCTTCATCCAGGCGTTAATCTCGAGATTAACGCCTGGATGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030958
SLCO5A1 MISSION shRNA Lentiviral Transduction Particles
solute carrier organic anion transporter family, member 5A1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030958.1-2847s1c1
Sequence:CCGGGCCTCAAATTCGTTGGGTTTACTCGAGTAAACCCAACGAATTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030958.1-1705s1c1
Sequence:CCGGCCCAATGTTTACTTTCCCAAACTCGAGTTTGGGAAAGTAAACATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030958.1-3087s1c1
Sequence:CCGGCCTTCCCAGAAGCAATAAGTTCTCGAGAACTTATTGCTTCTGGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030958.1-2669s1c1
Sequence:CCGGGCACTGGGAATGCAGTTTGTTCTCGAGAACAAACTGCATTCCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030958.1-1472s1c1
Sequence:CCGGCCAACCTACTTAGATGACAATCTCGAGATTGTCATCTAAGTAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030958.2-3384s21c1
Sequence:CCGGCAGTATACACAGCCGCTATTCCTCGAGGAATAGCGGCTGTGTATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030958.2-1118s21c1
Sequence:CCGGGACCTTCATCCAGGCGTTAATCTCGAGATTAACGCCTGGATGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks