EMAIL THIS PAGE TO A FRIEND

SLFN12

schlafen family member 12

Synonyms: SLFN3
Species: Human SLFN12(55106), domestic guinea pig Slfn12(100714670)
UniProtKB ID: Q8IYM2, A8K711, Q9NP47
Gene ID:
domestic guinea pig(100714670) schlafen family member 12
26 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018042 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018042 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018042 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU052461 MISSION® esiRNA esiRNA human SLFN12 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018042 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018042 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080645 predicted 1436
2 SASI_Hs01_00080646 predicted 2141
3 SASI_Hs01_00080647 predicted 1609
4 SASI_Hs01_00080648 predicted 1444
5 SASI_Hs01_00080649 predicted 511
6 SASI_Hs01_00080650 predicted 1365
7 SASI_Hs01_00080651 predicted 1532
8 SASI_Hs01_00080652 predicted 1978
9 SASI_Hs01_00080653 predicted 672
10 SASI_Hs02_00351162 predicted 1901
11 SASI_Hs01_00080654 predicted 2049
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018042
SLFN12 MISSION shRNA Bacterial Glycerol Stock
schlafen family member 12
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018042.2-1423s1c1
Sequence:CCGGCCAGTTCATATGAAGAGGTGACTCGAGTCACCTCTTCATATGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018042.2-1526s1c1
Sequence:CCGGGCTATCAGGAAGGATAACGTACTCGAGTACGTTATCCTTCCTGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018042.2-1145s1c1
Sequence:CCGGCCTCGATGACTTAGAAAGAGACTCGAGTCTCTTTCTAAGTCATCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018042.2-1343s1c1
Sequence:CCGGGCATGTGAAAGATAACCGTGTCTCGAGACACGGTTATCTTTCACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018042.2-1918s1c1
Sequence:CCGGCGCAAGTAATTTACCCTGAATCTCGAGATTCAGGGTAAATTACTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018042.2-653s1c1
Sequence:CCGGGTACTTAGACTTCATGCAGAACTCGAGTTCTGCATGAAGTCTAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151671    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018042.2-2212s1c1
Sequence:CCGGGCAACTTAATGTGATGTTGGACTCGAGTCCAACATCACATTAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152110    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018042.2-2275s1c1
Sequence:CCGGCACAGATATTGTTTGAGGGATCTCGAGATCCCTCAAACAATATCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018042.2-940s1c1
Sequence:CCGGCAGAACTTGATCGGAAAGAAACTCGAGTTTCTTTCCGATCAAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018042.2-2051s1c1
Sequence:CCGGCGGTATAGATTGCTTTCAGAACTCGAGTTCTGAAAGCAATCTATACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018042
SLFN12 MISSION shRNA shRNA Plasmid DNA
schlafen family member 12
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018042.2-1423s1c1
Sequence:CCGGCCAGTTCATATGAAGAGGTGACTCGAGTCACCTCTTCATATGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018042.2-1526s1c1
Sequence:CCGGGCTATCAGGAAGGATAACGTACTCGAGTACGTTATCCTTCCTGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018042.2-1145s1c1
Sequence:CCGGCCTCGATGACTTAGAAAGAGACTCGAGTCTCTTTCTAAGTCATCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018042.2-1343s1c1
Sequence:CCGGGCATGTGAAAGATAACCGTGTCTCGAGACACGGTTATCTTTCACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018042.2-1918s1c1
Sequence:CCGGCGCAAGTAATTTACCCTGAATCTCGAGATTCAGGGTAAATTACTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018042.2-653s1c1
Sequence:CCGGGTACTTAGACTTCATGCAGAACTCGAGTTCTGCATGAAGTCTAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151671    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018042.2-2212s1c1
Sequence:CCGGGCAACTTAATGTGATGTTGGACTCGAGTCCAACATCACATTAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152110    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018042.2-2275s1c1
Sequence:CCGGCACAGATATTGTTTGAGGGATCTCGAGATCCCTCAAACAATATCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018042.2-940s1c1
Sequence:CCGGCAGAACTTGATCGGAAAGAAACTCGAGTTTCTTTCCGATCAAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018042.2-2051s1c1
Sequence:CCGGCGGTATAGATTGCTTTCAGAACTCGAGTTCTGAAAGCAATCTATACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018042
SLFN12 MISSION shRNA Lentiviral Transduction Particles
schlafen family member 12
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018042.2-1423s1c1
Sequence:CCGGCCAGTTCATATGAAGAGGTGACTCGAGTCACCTCTTCATATGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018042.2-1526s1c1
Sequence:CCGGGCTATCAGGAAGGATAACGTACTCGAGTACGTTATCCTTCCTGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018042.2-1145s1c1
Sequence:CCGGCCTCGATGACTTAGAAAGAGACTCGAGTCTCTTTCTAAGTCATCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018042.2-1343s1c1
Sequence:CCGGGCATGTGAAAGATAACCGTGTCTCGAGACACGGTTATCTTTCACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018042.2-1918s1c1
Sequence:CCGGCGCAAGTAATTTACCCTGAATCTCGAGATTCAGGGTAAATTACTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018042.2-653s1c1
Sequence:CCGGGTACTTAGACTTCATGCAGAACTCGAGTTCTGCATGAAGTCTAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151671    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018042.2-2212s1c1
Sequence:CCGGGCAACTTAATGTGATGTTGGACTCGAGTCCAACATCACATTAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152110    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018042.2-2275s1c1
Sequence:CCGGCACAGATATTGTTTGAGGGATCTCGAGATCCCTCAAACAATATCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018042.2-940s1c1
Sequence:CCGGCAGAACTTGATCGGAAAGAAACTCGAGTTTCTTTCCGATCAAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018042.2-2051s1c1
Sequence:CCGGCGGTATAGATTGCTTTCAGAACTCGAGTTCTGAAAGCAATCTATACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks