EMAIL THIS PAGE TO A FRIEND

SLIT1

slit homolog 1 (Drosophila)

Synonyms: MEGF4 SLIL1 SLIT-1 SLIT3
UniProtKB ID: O75093, Q5T0V1, Q8WWZ2, Q9UIL7
Gene ID:
Mouse(20562) slit homolog 1 (Drosophila)
Rat(65047) slit homolog 1 (Drosophila)
cow(510761) slit homolog 1 (Drosophila)
sheep(101112777) slit homolog 1 (Drosophila)
naked mole-rat(101722713) slit homolog 1 (Drosophila)
domestic guinea pig(100714910) slit homolog 1 (Drosophila)
chicken(395293) slit homolog 1 (Drosophila)
domestic cat(101098258) slit homolog 1 (Drosophila)
dog(595147) slit homolog 1
dog(486818) slit homolog 1 (Drosophila)
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003061 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003061 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003061 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015748 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015748 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015748 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU016881 MISSION® esiRNA esiRNA targeting mouse Slit1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003061 Rosetta Predictions human pricing
NM_022953 Rosetta Predictions rat pricing
XM_579472 Rosetta Predictions rat pricing
NM_015748 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003061 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054692 predicted 455
2 SASI_Hs01_00054693 predicted 4102
3 SASI_Hs01_00054694 predicted 1254
4 SASI_Hs01_00054695 predicted 1968
5 SASI_Hs01_00054696 predicted 4000
6 SASI_Hs01_00054697 predicted 1371
7 SASI_Hs02_00334976 predicted 1374
8 SASI_Hs01_00054698 predicted 2534
9 SASI_Hs01_00054700 predicted 3264
10 SASI_Hs01_00054701 predicted 3462
11 SASI_Hs01_00054699 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022953 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064179 predicted 1254
2 SASI_Rn01_00064180 predicted 366
3 SASI_Rn01_00064181 predicted 1166
4 SASI_Rn01_00064182 predicted 1803
5 SASI_Rn01_00064183 predicted 1568
6 SASI_Rn02_00263686 predicted 3653
7 SASI_Rn01_00064184 predicted 1795
8 SASI_Rn01_00064185 predicted 4187
9 SASI_Rn01_00064186 predicted 2885
10 SASI_Rn01_00064187 predicted 904
11 SASI_Rn01_00064188 predicted 3161
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579472 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00174804 predicted 3133
2 SASI_Rn01_00174805 predicted 2953
3 SASI_Rn01_00174806 predicted 3118
4 SASI_Rn01_00174807 predicted 3139
5 SASI_Rn01_00174808 predicted 1279
6 SASI_Rn01_00174809 predicted 2787
7 SASI_Rn01_00174810 predicted 417
8 SASI_Rn01_00174811 predicted 2670
9 SASI_Rn01_00174812 predicted 2912
10 SASI_Rn01_00174813 predicted 1244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015748 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135846 predicted 648
2 SASI_Mm01_00135847 predicted 2163
3 SASI_Mm01_00135848 predicted 2085
4 SASI_Mm01_00135849 predicted 4029
5 SASI_Mm02_00323078 predicted 3943
6 SASI_Mm01_00135850 predicted 4474
7 SASI_Mm01_00135851 predicted 799
8 SASI_Mm01_00135852 predicted 3457
9 SASI_Mm01_00135853 predicted 3166
10 SASI_Mm01_00135854 predicted 4055
11 SASI_Mm01_00135855 predicted 1575
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003061
SLIT1 MISSION shRNA Bacterial Glycerol Stock
slit homolog 1 (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003061.2-2089s21c1
Sequence:CCGGGATGGCTTGAGGACCCTAATGCTCGAGCATTAGGGTCCTCAAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003061.2-2534s21c1
Sequence:CCGGAGAATGTCACAGAACTCTATTCTCGAGAATAGAGTTCTGTGACATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003061.2-3969s21c1
Sequence:CCGGGACGATCAACGATGGGCAATTCTCGAGAATTGCCCATCGTTGATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003061.1-1857s1c1
Sequence:CCGGCGGCAGAACTGCGATTGAATACTCGAGTATTCAATCGCAGTTCTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003061.1-1255s1c1
Sequence:CCGGCAACAATCAGATCGCTGAGATCTCGAGATCTCAGCGATCTGATTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003061.1-4053s1c1
Sequence:CCGGGCAAACATTACACGCTCAACACTCGAGTGTTGAGCGTGTAATGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003061.1-2608s1c1
Sequence:CCGGCAACAACAAGATCAGTTCCTTCTCGAGAAGGAACTGATCTTGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003061.1-455s1c1
Sequence:CCGGCGGATCCATAAGAATGACTTTCTCGAGAAAGTCATTCTTATGGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003061.1-1867s1c1
Sequence:CCGGGCGATTGAATAACAATGAGATCTCGAGATCTCATTGTTATTCAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003061.1-3998s1c1
Sequence:CCGGCAGATGGTGAATCTCTCCATTCTCGAGAATGGAGAGATTCACCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003061
SLIT1 MISSION shRNA shRNA Plasmid DNA
slit homolog 1 (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003061.2-2089s21c1
Sequence:CCGGGATGGCTTGAGGACCCTAATGCTCGAGCATTAGGGTCCTCAAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003061.2-2534s21c1
Sequence:CCGGAGAATGTCACAGAACTCTATTCTCGAGAATAGAGTTCTGTGACATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003061.2-3969s21c1
Sequence:CCGGGACGATCAACGATGGGCAATTCTCGAGAATTGCCCATCGTTGATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003061.1-1857s1c1
Sequence:CCGGCGGCAGAACTGCGATTGAATACTCGAGTATTCAATCGCAGTTCTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003061.1-1255s1c1
Sequence:CCGGCAACAATCAGATCGCTGAGATCTCGAGATCTCAGCGATCTGATTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003061.1-4053s1c1
Sequence:CCGGGCAAACATTACACGCTCAACACTCGAGTGTTGAGCGTGTAATGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003061.1-2608s1c1
Sequence:CCGGCAACAACAAGATCAGTTCCTTCTCGAGAAGGAACTGATCTTGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003061.1-455s1c1
Sequence:CCGGCGGATCCATAAGAATGACTTTCTCGAGAAAGTCATTCTTATGGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003061.1-1867s1c1
Sequence:CCGGGCGATTGAATAACAATGAGATCTCGAGATCTCATTGTTATTCAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003061.1-3998s1c1
Sequence:CCGGCAGATGGTGAATCTCTCCATTCTCGAGAATGGAGAGATTCACCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003061
SLIT1 MISSION shRNA Lentiviral Transduction Particles
slit homolog 1 (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003061.2-2089s21c1
Sequence:CCGGGATGGCTTGAGGACCCTAATGCTCGAGCATTAGGGTCCTCAAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003061.2-2534s21c1
Sequence:CCGGAGAATGTCACAGAACTCTATTCTCGAGAATAGAGTTCTGTGACATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003061.2-3969s21c1
Sequence:CCGGGACGATCAACGATGGGCAATTCTCGAGAATTGCCCATCGTTGATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003061.1-1857s1c1
Sequence:CCGGCGGCAGAACTGCGATTGAATACTCGAGTATTCAATCGCAGTTCTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003061.1-1255s1c1
Sequence:CCGGCAACAATCAGATCGCTGAGATCTCGAGATCTCAGCGATCTGATTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003061.1-4053s1c1
Sequence:CCGGGCAAACATTACACGCTCAACACTCGAGTGTTGAGCGTGTAATGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003061.1-2608s1c1
Sequence:CCGGCAACAACAAGATCAGTTCCTTCTCGAGAAGGAACTGATCTTGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003061.1-455s1c1
Sequence:CCGGCGGATCCATAAGAATGACTTTCTCGAGAAAGTCATTCTTATGGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003061.1-1867s1c1
Sequence:CCGGGCGATTGAATAACAATGAGATCTCGAGATCTCATTGTTATTCAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003061.1-3998s1c1
Sequence:CCGGCAGATGGTGAATCTCTCCATTCTCGAGAATGGAGAGATTCACCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015748
SLIT1 MISSION shRNA Bacterial Glycerol Stock
slit homolog 1 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015748.1-2086s1c1
Sequence:CCGGCGACTGAACAACAATGAGATTCTCGAGAATCTCATTGTTGTTCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015748.1-3175s1c1
Sequence:CCGGGCCAAGAAGTTTGAATGCCAACTCGAGTTGGCATTCAAACTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015748.1-4468s1c1
Sequence:CCGGCGCAAACTCTACTGTCTACATCTCGAGATGTAGACAGTAGAGTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015748.1-1395s1c1
Sequence:CCGGCCTGGAGTTGAACGGTATCAACTCGAGTTGATACCGTTCAACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015748.1-673s1c1
Sequence:CCGGCGGATCCACAAGAATGACTTTCTCGAGAAAGTCATTCTTGTGGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015748
SLIT1 MISSION shRNA shRNA Plasmid DNA
slit homolog 1 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015748.1-2086s1c1
Sequence:CCGGCGACTGAACAACAATGAGATTCTCGAGAATCTCATTGTTGTTCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015748.1-3175s1c1
Sequence:CCGGGCCAAGAAGTTTGAATGCCAACTCGAGTTGGCATTCAAACTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015748.1-4468s1c1
Sequence:CCGGCGCAAACTCTACTGTCTACATCTCGAGATGTAGACAGTAGAGTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015748.1-1395s1c1
Sequence:CCGGCCTGGAGTTGAACGGTATCAACTCGAGTTGATACCGTTCAACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015748.1-673s1c1
Sequence:CCGGCGGATCCACAAGAATGACTTTCTCGAGAAAGTCATTCTTGTGGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015748
SLIT1 MISSION shRNA Lentiviral Transduction Particles
slit homolog 1 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015748.1-2086s1c1
Sequence:CCGGCGACTGAACAACAATGAGATTCTCGAGAATCTCATTGTTGTTCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015748.1-3175s1c1
Sequence:CCGGGCCAAGAAGTTTGAATGCCAACTCGAGTTGGCATTCAAACTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015748.1-4468s1c1
Sequence:CCGGCGCAAACTCTACTGTCTACATCTCGAGATGTAGACAGTAGAGTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015748.1-1395s1c1
Sequence:CCGGCCTGGAGTTGAACGGTATCAACTCGAGTTGATACCGTTCAACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015748.1-673s1c1
Sequence:CCGGCGGATCCACAAGAATGACTTTCTCGAGAAAGTCATTCTTGTGGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks