EMAIL THIS PAGE TO A FRIEND

SLITRK4

SLIT and NTRK-like family, member 4

UniProtKB ID: Q8IW52, Q5JXG3, Q8TCM8, Q96DL3
Gene ID:
Human(139065) Summary: This gene encodes a transmembrane protein belonging to the the SLITRK family. These family members include two N-terminal leucine-rich repeat domains similar to those found in the axonal growth-controlling protein SLIT, as well as C-terminal regions similar to neurotrophin receptors. Studies of an homologous protein in mouse suggest that this family member functions to suppress neurite outgrowth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Mouse(245446) SLIT and NTRK-like family, member 4
Rat(302473) SLIT and NTRK-like family, member 4
Zebrafish(558123) slit and trk like 4 protein
chicken(422287) SLIT and NTRK-like family, member 4
dog(492183) SLIT and NTRK-like family, member 4
Horse(100055730) SLIT and NTRK-like family, member 4
cow(530936) SLIT and NTRK-like family, member 4
sheep(101120726) SLIT and NTRK-like family, member 4
naked mole-rat(101718763) SLIT and NTRK-like family, member 4
99 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173078 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173078 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173078 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178740 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178740 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178740 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173078 Rosetta Predictions human pricing
NM_001106947 Rosetta Predictions rat pricing
XR_006593 Rosetta Predictions rat pricing
NM_178740 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173078 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065846 predicted 1114
2 SASI_Hs01_00065847 predicted 1351
3 SASI_Hs02_00368069 predicted 1623
4 SASI_Hs02_00368070 predicted 1643
5 SASI_Hs02_00368071 predicted 1560
6 SASI_Hs01_00065850 predicted 1510
7 SASI_Hs01_00065851 predicted 1305
8 SASI_Hs01_00065852 predicted 2871
9 SASI_Hs01_00065853 predicted 1097
10 SASI_Hs02_00368072 predicted 1993
11 SASI_Hs01_00065845 predicted 784
12 SASI_Hs01_00065848 predicted 1553
13 SASI_Hs01_00065849 predicted 1780
14 SASI_Hs01_00065854 predicted 534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106947 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223976 predicted 775
2 SASI_Rn02_00223977 predicted 1577
3 SASI_Rn02_00223978 predicted 518
4 SASI_Rn02_00223979 predicted 1740
5 SASI_Rn02_00223980 predicted 1096
6 SASI_Rn02_00223981 predicted 1052
7 SASI_Rn02_00223982 predicted 942
8 SASI_Rn02_00223983 predicted 1496
9 SASI_Rn02_00223984 predicted 1884
10 SASI_Rn02_00223985 predicted 2426
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_006593 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00168271 predicted 1454
2 SASI_Rn01_00168272 predicted 1609
3 SASI_Rn01_00168273 predicted 976
4 SASI_Rn01_00168274 predicted 2727
5 SASI_Rn01_00168275 predicted 925
6 SASI_Rn01_00168276 predicted 3143
7 SASI_Rn01_00168277 predicted 1371
8 SASI_Rn01_00168278 predicted 1768
9 SASI_Rn01_00168279 predicted 2302
10 SASI_Rn01_00168280 predicted 3018
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178740 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038422 predicted 726
2 SASI_Mm01_00038423 predicted 1534
3 SASI_Mm01_00038424 predicted 1057
4 SASI_Mm01_00038426 predicted 1837
5 SASI_Mm01_00038427 predicted 473
6 SASI_Mm01_00038428 predicted 1453
7 SASI_Mm01_00038429 predicted 892
8 SASI_Mm01_00038430 predicted 2383
9 SASI_Mm01_00038431 predicted 997
10 SASI_Mm02_00349277 predicted 1270
11 SASI_Mm01_00038425 predicted 498
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173078
SLITRK4 MISSION shRNA Bacterial Glycerol Stock
SLIT and NTRK-like family, member 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173078.2-3130s21c1
Sequence:CCGGGGATGCTTTATACACATAATACTCGAGTATTATGTGTATAAAGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173078.2-2905s21c1
Sequence:CCGGCTTCATACAGAGGACATTTATCTCGAGATAAATGTCCTCTGTATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173078.2-1619s21c1
Sequence:CCGGGTGATTAAGGGAGACGTATTTCTCGAGAAATACGTCTCCCTTAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173078.2-538s21c1
Sequence:CCGGGAAACCACCTTGGTCTAATTTCTCGAGAAATTAGACCAAGGTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173078.2-2549s1c1
Sequence:CCGGGCCGACAAGGAGAAAGATTTACTCGAGTAAATCTTTCTCCTTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173078.2-407s1c1
Sequence:CCGGGCCCTGATTTCTTCGACAAATCTCGAGATTTGTCGAAGAAATCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173078.2-1029s1c1
Sequence:CCGGGCTGTGATTTATTGCCCTTAACTCGAGTTAAGGGCAATAAATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173078.2-824s1c1
Sequence:CCGGGCCTTCAATAAGCTCCACAAACTCGAGTTTGTGGAGCTTATTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173078.2-3203s1c1
Sequence:CCGGCGTCTCTTTGTGCTTTGTAAACTCGAGTTTACAAAGCACAAAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173078
SLITRK4 MISSION shRNA shRNA Plasmid DNA
SLIT and NTRK-like family, member 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173078.2-3130s21c1
Sequence:CCGGGGATGCTTTATACACATAATACTCGAGTATTATGTGTATAAAGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173078.2-2905s21c1
Sequence:CCGGCTTCATACAGAGGACATTTATCTCGAGATAAATGTCCTCTGTATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173078.2-1619s21c1
Sequence:CCGGGTGATTAAGGGAGACGTATTTCTCGAGAAATACGTCTCCCTTAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173078.2-538s21c1
Sequence:CCGGGAAACCACCTTGGTCTAATTTCTCGAGAAATTAGACCAAGGTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173078.2-2549s1c1
Sequence:CCGGGCCGACAAGGAGAAAGATTTACTCGAGTAAATCTTTCTCCTTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173078.2-407s1c1
Sequence:CCGGGCCCTGATTTCTTCGACAAATCTCGAGATTTGTCGAAGAAATCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173078.2-1029s1c1
Sequence:CCGGGCTGTGATTTATTGCCCTTAACTCGAGTTAAGGGCAATAAATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173078.2-824s1c1
Sequence:CCGGGCCTTCAATAAGCTCCACAAACTCGAGTTTGTGGAGCTTATTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173078.2-3203s1c1
Sequence:CCGGCGTCTCTTTGTGCTTTGTAAACTCGAGTTTACAAAGCACAAAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173078
SLITRK4 MISSION shRNA Lentiviral Transduction Particles
SLIT and NTRK-like family, member 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173078.2-3130s21c1
Sequence:CCGGGGATGCTTTATACACATAATACTCGAGTATTATGTGTATAAAGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173078.2-2905s21c1
Sequence:CCGGCTTCATACAGAGGACATTTATCTCGAGATAAATGTCCTCTGTATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173078.2-1619s21c1
Sequence:CCGGGTGATTAAGGGAGACGTATTTCTCGAGAAATACGTCTCCCTTAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173078.2-538s21c1
Sequence:CCGGGAAACCACCTTGGTCTAATTTCTCGAGAAATTAGACCAAGGTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173078.2-2549s1c1
Sequence:CCGGGCCGACAAGGAGAAAGATTTACTCGAGTAAATCTTTCTCCTTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173078.2-407s1c1
Sequence:CCGGGCCCTGATTTCTTCGACAAATCTCGAGATTTGTCGAAGAAATCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173078.2-1029s1c1
Sequence:CCGGGCTGTGATTTATTGCCCTTAACTCGAGTTAAGGGCAATAAATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173078.2-824s1c1
Sequence:CCGGGCCTTCAATAAGCTCCACAAACTCGAGTTTGTGGAGCTTATTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173078.2-3203s1c1
Sequence:CCGGCGTCTCTTTGTGCTTTGTAAACTCGAGTTTACAAAGCACAAAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178740
SLITRK4 MISSION shRNA Bacterial Glycerol Stock
SLIT and NTRK-like family, member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178740.3-3385s1c1
Sequence:CCGGGCATCTTGAAATTGCTGGATTCTCGAGAATCCAGCAATTTCAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178740.3-690s1c1
Sequence:CCGGGCTGACACTTTCCTTGGCATACTCGAGTATGCCAAGGAAAGTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178740.3-863s1c1
Sequence:CCGGCCATTTGGATATACGAGGAAACTCGAGTTTCCTCGTATATCCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178740.3-1455s1c1
Sequence:CCGGGCCAAGAAGTTGCATGTCAATCTCGAGATTGACATGCAACTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178740.3-351s1c1
Sequence:CCGGGCCCTGATTTCTTCTACAAATCTCGAGATTTGTAGAAGAAATCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178740
SLITRK4 MISSION shRNA shRNA Plasmid DNA
SLIT and NTRK-like family, member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178740.3-3385s1c1
Sequence:CCGGGCATCTTGAAATTGCTGGATTCTCGAGAATCCAGCAATTTCAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178740.3-690s1c1
Sequence:CCGGGCTGACACTTTCCTTGGCATACTCGAGTATGCCAAGGAAAGTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178740.3-863s1c1
Sequence:CCGGCCATTTGGATATACGAGGAAACTCGAGTTTCCTCGTATATCCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178740.3-1455s1c1
Sequence:CCGGGCCAAGAAGTTGCATGTCAATCTCGAGATTGACATGCAACTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178740.3-351s1c1
Sequence:CCGGGCCCTGATTTCTTCTACAAATCTCGAGATTTGTAGAAGAAATCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178740
SLITRK4 MISSION shRNA Lentiviral Transduction Particles
SLIT and NTRK-like family, member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178740.3-3385s1c1
Sequence:CCGGGCATCTTGAAATTGCTGGATTCTCGAGAATCCAGCAATTTCAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178740.3-690s1c1
Sequence:CCGGGCTGACACTTTCCTTGGCATACTCGAGTATGCCAAGGAAAGTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178740.3-863s1c1
Sequence:CCGGCCATTTGGATATACGAGGAAACTCGAGTTTCCTCGTATATCCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178740.3-1455s1c1
Sequence:CCGGGCCAAGAAGTTGCATGTCAATCTCGAGATTGACATGCAACTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178740.3-351s1c1
Sequence:CCGGGCCCTGATTTCTTCTACAAATCTCGAGATTTGTAGAAGAAATCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks