EMAIL THIS PAGE TO A FRIEND

SLK

STE20-like kinase

Synonyms: LOSK STK2 bA16H23.1 se20-9
Gene ID:
Mouse(20874) STE20-like kinase
Rat(54308) STE20-like kinase
domestic guinea pig(100135621) STE20-like kinase
Domestic Rabbit(100347081) STE20-like kinase
naked mole-rat(101709480) STE20-like kinase
cow(535342) STE20-like kinase
sheep(101114150) STE20-like kinase
chicken(423878) STE20-like kinase
domestic cat(101096609) STE20-like kinase
dog(486876) STE20-like kinase
Horse(100059564) STE20-like kinase
186 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014720 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014720 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014720 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009289 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009289 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009289 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014720 siRNAs that have been validated in the lab human pricing
NM_019349 Rosetta Predictions rat pricing
NM_009289 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014720 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084769 validated 3169
2 SASI_Hs01_00084770 predicted 3243
3 SASI_Hs01_00084771 predicted 2056
4 SASI_Hs01_00084772 predicted 3521
5 SASI_Hs02_00346151 predicted 378
6 SASI_Hs01_00084774 predicted 527
7 SASI_Hs01_00084775 predicted 2729
8 SASI_Hs02_00346152 predicted 2359
9 SASI_Hs01_00084776 predicted 2911
10 SASI_Hs02_00346153 predicted 1343
11 SASI_Hs01_00084773 predicted 1648
12 SASI_Hs01_00084777 predicted 1754
13 SASI_Hs01_00084778 predicted 1279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019349 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060655 predicted 3225
2 SASI_Rn01_00060656 predicted 581
3 SASI_Rn01_00060658 predicted 2285
4 SASI_Rn01_00060659 predicted 2542
5 SASI_Rn01_00060660 predicted 3134
6 SASI_Rn01_00060661 predicted 410
7 SASI_Rn01_00060663 predicted 1647
8 SASI_Rn02_00262351 predicted 3154
9 SASI_Rn01_00060664 predicted 395
10 SASI_Rn02_00262352 predicted 3201
11 SASI_Rn01_00060657 predicted 1484
12 SASI_Rn01_00060662 predicted 2732
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009289 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315796 predicted 3179
2 SASI_Mm01_00070868 predicted 1772
3 SASI_Mm01_00070869 predicted 3311
4 SASI_Mm01_00070870 predicted 3854
5 SASI_Mm01_00070872 predicted 417
6 SASI_Mm01_00070873 predicted 2297
7 SASI_Mm01_00070875 predicted 405
8 SASI_Mm01_00070876 predicted 3064
9 SASI_Mm02_00315797 predicted 590
10 SASI_Mm02_00315798 predicted 665
11 SASI_Mm01_00070871 predicted 1658
12 SASI_Mm01_00070874 predicted 1538
13 SASI_Mm01_00070877 predicted 835
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014720
VALIDATED
SLK MISSION shRNA Bacterial Glycerol Stock
STE20-like kinase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_014720.x-4152s1c1
Sequence:CCGGTGGCTCTTTCAGTATGTCATTCTCGAGAATGACATACTGAAAGAGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014720.x-1665s1c1
Sequence:CCGGCCACCACTGATGAACCTGAAACTCGAGTTTCAGGTTCATCAGTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014720.x-3544s1c1
Sequence:CCGGCGAGAAGGAAACAGAGCAAATCTCGAGATTTGCTCTGTTTCCTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014720.x-1747s1c1
Sequence:CCGGCCATGACAGAACAGCAGTAATCTCGAGATTACTGCTGTTCTGTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014720.2-2980s1c1
Sequence:CCGGGAAGGCAGAGTTAGCTAATATCTCGAGATATTAGCTAACTCTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014720.2-1662s1c1
Sequence:CCGGGCAATACAAGTGATGTGATAGCTCGAGCTATCACATCACTTGTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014720.2-2153s1c1
Sequence:CCGGCCTGTTCTAATACCCAGTATTCTCGAGAATACTGGGTATTAGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014720.2-324s1c1
Sequence:CCGGCCTTCTATTATGAGAACAATCCTCGAGGATTGTTCTCATAATAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014720
VALIDATED
SLK MISSION shRNA shRNA Plasmid DNA
STE20-like kinase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_014720.x-4152s1c1
Sequence:CCGGTGGCTCTTTCAGTATGTCATTCTCGAGAATGACATACTGAAAGAGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014720.x-1665s1c1
Sequence:CCGGCCACCACTGATGAACCTGAAACTCGAGTTTCAGGTTCATCAGTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014720.x-3544s1c1
Sequence:CCGGCGAGAAGGAAACAGAGCAAATCTCGAGATTTGCTCTGTTTCCTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014720.x-1747s1c1
Sequence:CCGGCCATGACAGAACAGCAGTAATCTCGAGATTACTGCTGTTCTGTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014720.2-2980s1c1
Sequence:CCGGGAAGGCAGAGTTAGCTAATATCTCGAGATATTAGCTAACTCTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014720.2-1662s1c1
Sequence:CCGGGCAATACAAGTGATGTGATAGCTCGAGCTATCACATCACTTGTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014720.2-2153s1c1
Sequence:CCGGCCTGTTCTAATACCCAGTATTCTCGAGAATACTGGGTATTAGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014720.2-324s1c1
Sequence:CCGGCCTTCTATTATGAGAACAATCCTCGAGGATTGTTCTCATAATAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014720
VALIDATED
SLK MISSION shRNA Lentiviral Transduction Particles
STE20-like kinase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_014720.x-4152s1c1
Sequence:CCGGTGGCTCTTTCAGTATGTCATTCTCGAGAATGACATACTGAAAGAGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014720.x-1665s1c1
Sequence:CCGGCCACCACTGATGAACCTGAAACTCGAGTTTCAGGTTCATCAGTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014720.x-3544s1c1
Sequence:CCGGCGAGAAGGAAACAGAGCAAATCTCGAGATTTGCTCTGTTTCCTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014720.x-1747s1c1
Sequence:CCGGCCATGACAGAACAGCAGTAATCTCGAGATTACTGCTGTTCTGTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014720.2-2980s1c1
Sequence:CCGGGAAGGCAGAGTTAGCTAATATCTCGAGATATTAGCTAACTCTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014720.2-1662s1c1
Sequence:CCGGGCAATACAAGTGATGTGATAGCTCGAGCTATCACATCACTTGTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014720.2-2153s1c1
Sequence:CCGGCCTGTTCTAATACCCAGTATTCTCGAGAATACTGGGTATTAGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014720.2-324s1c1
Sequence:CCGGCCTTCTATTATGAGAACAATCCTCGAGGATTGTTCTCATAATAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009289
VALIDATED
SLK MISSION shRNA Bacterial Glycerol Stock
STE20-like kinase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009289.1-331s1c1
Sequence:CCGGGCCCAGAATAAAGAGACCAATCTCGAGATTGGTCTCTTTATTCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009289.1-2227s1c1
Sequence:CCGGGCACAGAAAGTGCCCGTTAAACTCGAGTTTAACGGGCACTTTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009289.1-591s1c1
Sequence:CCGGGCAGACATTAGAGGCATTGAACTCGAGTTCAATGCCTCTAATGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009289.1-3325s1c1
Sequence:CCGGCGCTACAATCAACGACTTATTCTCGAGAATAAGTCGTTGATTGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009289.1-2293s1c1
Sequence:CCGGCCTGTCTTAATACCCAGTATTCTCGAGAATACTGGGTATTAAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009289.3-403s21c1
Sequence:CCGGTATGGTTGAGATTGACATATTCTCGAGAATATGTCAATCTCAACCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009289.3-2874s21c1
Sequence:CCGGACGAAGCCAAGCGCATCAAAGCTCGAGCTTTGATGCGCTTGGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361479    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009289.3-4275s21c1
Sequence:CCGGTGCTATAGAATTGGGATAATTCTCGAGAATTATCCCAATTCTATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009289
VALIDATED
SLK MISSION shRNA shRNA Plasmid DNA
STE20-like kinase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009289.1-331s1c1
Sequence:CCGGGCCCAGAATAAAGAGACCAATCTCGAGATTGGTCTCTTTATTCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009289.1-2227s1c1
Sequence:CCGGGCACAGAAAGTGCCCGTTAAACTCGAGTTTAACGGGCACTTTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009289.1-591s1c1
Sequence:CCGGGCAGACATTAGAGGCATTGAACTCGAGTTCAATGCCTCTAATGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009289.1-3325s1c1
Sequence:CCGGCGCTACAATCAACGACTTATTCTCGAGAATAAGTCGTTGATTGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009289.1-2293s1c1
Sequence:CCGGCCTGTCTTAATACCCAGTATTCTCGAGAATACTGGGTATTAAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009289.3-403s21c1
Sequence:CCGGTATGGTTGAGATTGACATATTCTCGAGAATATGTCAATCTCAACCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009289.3-2874s21c1
Sequence:CCGGACGAAGCCAAGCGCATCAAAGCTCGAGCTTTGATGCGCTTGGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361479    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009289.3-4275s21c1
Sequence:CCGGTGCTATAGAATTGGGATAATTCTCGAGAATTATCCCAATTCTATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009289
VALIDATED
SLK MISSION shRNA Lentiviral Transduction Particles
STE20-like kinase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009289.1-331s1c1
Sequence:CCGGGCCCAGAATAAAGAGACCAATCTCGAGATTGGTCTCTTTATTCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009289.1-2227s1c1
Sequence:CCGGGCACAGAAAGTGCCCGTTAAACTCGAGTTTAACGGGCACTTTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009289.1-591s1c1
Sequence:CCGGGCAGACATTAGAGGCATTGAACTCGAGTTCAATGCCTCTAATGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009289.1-3325s1c1
Sequence:CCGGCGCTACAATCAACGACTTATTCTCGAGAATAAGTCGTTGATTGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009289.1-2293s1c1
Sequence:CCGGCCTGTCTTAATACCCAGTATTCTCGAGAATACTGGGTATTAAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009289.3-403s21c1
Sequence:CCGGTATGGTTGAGATTGACATATTCTCGAGAATATGTCAATCTCAACCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009289.3-2874s21c1
Sequence:CCGGACGAAGCCAAGCGCATCAAAGCTCGAGCTTTGATGCGCTTGGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361479    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009289.3-4275s21c1
Sequence:CCGGTGCTATAGAATTGGGATAATTCTCGAGAATTATCCCAATTCTATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks