EMAIL THIS PAGE TO A FRIEND

SLX4

SLX4 structure-specific endonuclease subunit

Synonyms: BTBD12 FANCP MUS312
UniProtKB ID: Q8IY92, Q69YT8, Q8TF15, Q96JP1
Gene ID:
Human(84464) Summary: This gene encodes a structure-specific endonuclease subunit. The encoded protein contains a central BTB domain and it forms a multiprotein complex with the ERCC4(XPF)-ERCC1, MUS81-EME1, and SLX1 endonucleases, and also associates with MSH2/MSH3 mismatch repair complex, telomere binding complex TERF2(TRF2)-TERF2IP(RAP1), the protein kinase PLK1 and the uncharacterized protein C20orf94. The multiprotein complex is required for repair of specific types of DNA lesions and is critical for cellular responses to replication fork failure. The encoded protein acts as a docking platform for the assembly of multiple structure-specific endonucleases.[provided by RefSeq, Jan 2011]
Mouse(52864) SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)
Rat(302953) SLX4 structure-specific endonuclease subunit
Zebrafish(100001183) SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)
Horse(100069533) SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)
domestic cat(101095218) SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)
chicken(416665) SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)
dog(479867) SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)
cow(512193) SLX4 structure-specific endonuclease subunit
sheep(101123086) SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)
domestic guinea pig(100718161) SLX4 structure-specific endonuclease subunit
naked mole-rat(101709821) SLX4 structure-specific endonuclease subunit
101 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032444 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032444 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032444 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177472 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177472 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177472 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU146661 MISSION® esiRNA esiRNA targeting mouse Slx4 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032444 Rosetta Predictions human pricing
XM_001079342 Rosetta Predictions rat pricing
XM_220211 Rosetta Predictions rat pricing
NM_177472 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032444 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069744 predicted 4007
2 SASI_Hs01_00069745 predicted 5412
3 SASI_Hs01_00069746 predicted 2660
4 SASI_Hs01_00069747 predicted 3602
5 SASI_Hs01_00069748 predicted 1630
6 SASI_Hs01_00069749 predicted 3624
7 SASI_Hs01_00069750 predicted 1827
8 SASI_Hs01_00069751 predicted 1120
9 SASI_Hs01_00069752 predicted 3275
10 SASI_Hs01_00069753 predicted 4043
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079342 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00364058 predicted 3478
2 SASI_Rn02_00364059 predicted 4410
3 SASI_Rn02_00364060 predicted 3274
4 SASI_Rn02_00364061 predicted 901
5 SASI_Rn02_00364062 predicted 2172
6 SASI_Rn02_00364063 predicted 2770
7 SASI_Rn02_00364064 predicted 1713
8 SASI_Rn02_00364065 predicted 1696
9 SASI_Rn02_00364066 predicted 591
10 SASI_Rn02_00364067 predicted 4670
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220211 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379105 predicted 2879
2 SASI_Rn02_00379106 predicted 3822
3 SASI_Rn02_00379107 predicted 2679
4 SASI_Rn02_00379108 predicted 314
5 SASI_Rn02_00379109 predicted 1576
6 SASI_Rn02_00379110 predicted 2177
7 SASI_Rn02_00379111 predicted 1126
8 SASI_Rn02_00379112 predicted 1112
9 SASI_Rn02_00379113 predicted 4082
10 SASI_Rn02_00379114 predicted 2387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177472 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061279 predicted 2688
2 SASI_Mm01_00061280 predicted 1860
3 SASI_Mm01_00061281 predicted 949
4 SASI_Mm01_00061282 predicted 1431
5 SASI_Mm01_00061283 predicted 3787
6 SASI_Mm01_00061284 predicted 4294
7 SASI_Mm01_00061285 predicted 2435
8 SASI_Mm01_00061286 predicted 4305
9 SASI_Mm01_00061287 predicted 2863
10 SASI_Mm01_00061288 predicted 3658
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032444
SLX4 MISSION shRNA Bacterial Glycerol Stock
SLX4 structure-specific endonuclease subunit
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032444.1-1454s1c1
Sequence:CCGGGAACGAAGAAGATGAGGTCATCTCGAGATGACCTCATCTTCTTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032444.1-1605s1c1
Sequence:CCGGGATGTTGATGCAGATCAGGAACTCGAGTTCCTGATCTGCATCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032444.1-164s1c1
Sequence:CCGGGCTCCTCATCCAGTATGTGAACTCGAGTTCACATACTGGATGAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032444.1-1499s1c1
Sequence:CCGGGCTGGAGCTAGAACAAACCAACTCGAGTTGGTTTGTTCTAGCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032444.1-2637s1c1
Sequence:CCGGGAAGGGTTAGAGACACCCAAACTCGAGTTTGGGTGTCTCTAACCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032444.1-980s1c1
Sequence:CCGGCTCATCAACTCAGGGAGAGATCTCGAGATCTCTCCCTGAGTTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032444.1-1013s1c1
Sequence:CCGGCCAAATAACAAGTGAGCCCGACTCGAGTCGGGCTCACTTGTTATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032444.1-464s1c1
Sequence:CCGGCCAGGAACTCTTGAGGTCAATCTCGAGATTGACCTCAAGAGTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032444.1-3198s1c1
Sequence:CCGGGCATTTGAGTCTGCAGGTGAACTCGAGTTCACCTGCAGACTCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032444.1-1248s1c1
Sequence:CCGGGCTGTGCCATCAAAGCAGAAACTCGAGTTTCTGCTTTGATGGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032444.1-504s1c1
Sequence:CCGGGAAGCGGAGACTTTGTTGAAACTCGAGTTTCAACAAAGTCTCCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032444.1-2654s1c1
Sequence:CCGGCAAAGGTGCTAATCGGAAGAACTCGAGTTCTTCCGATTAGCACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032444
SLX4 MISSION shRNA shRNA Plasmid DNA
SLX4 structure-specific endonuclease subunit
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032444.1-1454s1c1
Sequence:CCGGGAACGAAGAAGATGAGGTCATCTCGAGATGACCTCATCTTCTTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032444.1-1605s1c1
Sequence:CCGGGATGTTGATGCAGATCAGGAACTCGAGTTCCTGATCTGCATCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032444.1-164s1c1
Sequence:CCGGGCTCCTCATCCAGTATGTGAACTCGAGTTCACATACTGGATGAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032444.1-1499s1c1
Sequence:CCGGGCTGGAGCTAGAACAAACCAACTCGAGTTGGTTTGTTCTAGCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032444.1-2637s1c1
Sequence:CCGGGAAGGGTTAGAGACACCCAAACTCGAGTTTGGGTGTCTCTAACCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032444.1-980s1c1
Sequence:CCGGCTCATCAACTCAGGGAGAGATCTCGAGATCTCTCCCTGAGTTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032444.1-1013s1c1
Sequence:CCGGCCAAATAACAAGTGAGCCCGACTCGAGTCGGGCTCACTTGTTATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032444.1-464s1c1
Sequence:CCGGCCAGGAACTCTTGAGGTCAATCTCGAGATTGACCTCAAGAGTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032444.1-3198s1c1
Sequence:CCGGGCATTTGAGTCTGCAGGTGAACTCGAGTTCACCTGCAGACTCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032444.1-1248s1c1
Sequence:CCGGGCTGTGCCATCAAAGCAGAAACTCGAGTTTCTGCTTTGATGGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032444.1-504s1c1
Sequence:CCGGGAAGCGGAGACTTTGTTGAAACTCGAGTTTCAACAAAGTCTCCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032444.1-2654s1c1
Sequence:CCGGCAAAGGTGCTAATCGGAAGAACTCGAGTTCTTCCGATTAGCACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032444
SLX4 MISSION shRNA Lentiviral Transduction Particles
SLX4 structure-specific endonuclease subunit
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032444.1-1454s1c1
Sequence:CCGGGAACGAAGAAGATGAGGTCATCTCGAGATGACCTCATCTTCTTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032444.1-1605s1c1
Sequence:CCGGGATGTTGATGCAGATCAGGAACTCGAGTTCCTGATCTGCATCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032444.1-164s1c1
Sequence:CCGGGCTCCTCATCCAGTATGTGAACTCGAGTTCACATACTGGATGAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032444.1-1499s1c1
Sequence:CCGGGCTGGAGCTAGAACAAACCAACTCGAGTTGGTTTGTTCTAGCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032444.1-2637s1c1
Sequence:CCGGGAAGGGTTAGAGACACCCAAACTCGAGTTTGGGTGTCTCTAACCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032444.1-980s1c1
Sequence:CCGGCTCATCAACTCAGGGAGAGATCTCGAGATCTCTCCCTGAGTTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032444.1-1013s1c1
Sequence:CCGGCCAAATAACAAGTGAGCCCGACTCGAGTCGGGCTCACTTGTTATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032444.1-464s1c1
Sequence:CCGGCCAGGAACTCTTGAGGTCAATCTCGAGATTGACCTCAAGAGTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032444.1-3198s1c1
Sequence:CCGGGCATTTGAGTCTGCAGGTGAACTCGAGTTCACCTGCAGACTCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032444.1-1248s1c1
Sequence:CCGGGCTGTGCCATCAAAGCAGAAACTCGAGTTTCTGCTTTGATGGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032444.1-504s1c1
Sequence:CCGGGAAGCGGAGACTTTGTTGAAACTCGAGTTTCAACAAAGTCTCCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032444.1-2654s1c1
Sequence:CCGGCAAAGGTGCTAATCGGAAGAACTCGAGTTCTTCCGATTAGCACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177472
VALIDATED
SLX4 MISSION shRNA Bacterial Glycerol Stock
SLX4 structure-specific endonuclease subunit
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177472.3-4943s1c1
Sequence:CCGGGCCCGAAAGGAGAAACTCAAACTCGAGTTTGAGTTTCTCCTTTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177472.3-421s1c1
Sequence:CCGGGCAACGGATGAAGCAGTTCAACTCGAGTTGAACTGCTTCATCCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177472.4-4775s21c1
Sequence:CCGGAGGCGCTATATCCGCTCTAAGCTCGAGCTTAGAGCGGATATAGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177472.4-3655s21c1
Sequence:CCGGGCCACACACACAGCCTATTACCTCGAGGTAATAGGCTGTGTGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177472.4-1891s21c1
Sequence:CCGGTGCGAGATGCCCACTTCTTATCTCGAGATAAGAAGTGGGCATCTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249954    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177472.4-5321s21c1
Sequence:CCGGCAAGCACAGCTGCCCTATATTCTCGAGAATATAGGGCAGCTGTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177472.4-4297s21c1
Sequence:CCGGGCCTCCCAAAGTGCCTATAACCTCGAGGTTATAGGCACTTTGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177472
VALIDATED
SLX4 MISSION shRNA shRNA Plasmid DNA
SLX4 structure-specific endonuclease subunit
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177472.3-4943s1c1
Sequence:CCGGGCCCGAAAGGAGAAACTCAAACTCGAGTTTGAGTTTCTCCTTTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177472.3-421s1c1
Sequence:CCGGGCAACGGATGAAGCAGTTCAACTCGAGTTGAACTGCTTCATCCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177472.4-4775s21c1
Sequence:CCGGAGGCGCTATATCCGCTCTAAGCTCGAGCTTAGAGCGGATATAGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177472.4-3655s21c1
Sequence:CCGGGCCACACACACAGCCTATTACCTCGAGGTAATAGGCTGTGTGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177472.4-1891s21c1
Sequence:CCGGTGCGAGATGCCCACTTCTTATCTCGAGATAAGAAGTGGGCATCTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249954    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177472.4-5321s21c1
Sequence:CCGGCAAGCACAGCTGCCCTATATTCTCGAGAATATAGGGCAGCTGTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177472.4-4297s21c1
Sequence:CCGGGCCTCCCAAAGTGCCTATAACCTCGAGGTTATAGGCACTTTGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177472
VALIDATED
SLX4 MISSION shRNA Lentiviral Transduction Particles
SLX4 structure-specific endonuclease subunit
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177472.3-4943s1c1
Sequence:CCGGGCCCGAAAGGAGAAACTCAAACTCGAGTTTGAGTTTCTCCTTTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177472.3-421s1c1
Sequence:CCGGGCAACGGATGAAGCAGTTCAACTCGAGTTGAACTGCTTCATCCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177472.4-4775s21c1
Sequence:CCGGAGGCGCTATATCCGCTCTAAGCTCGAGCTTAGAGCGGATATAGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177472.4-3655s21c1
Sequence:CCGGGCCACACACACAGCCTATTACCTCGAGGTAATAGGCTGTGTGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177472.4-1891s21c1
Sequence:CCGGTGCGAGATGCCCACTTCTTATCTCGAGATAAGAAGTGGGCATCTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249954    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177472.4-5321s21c1
Sequence:CCGGCAAGCACAGCTGCCCTATATTCTCGAGAATATAGGGCAGCTGTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177472.4-4297s21c1
Sequence:CCGGGCCTCCCAAAGTGCCTATAACCTCGAGGTTATAGGCACTTTGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks