EMAIL THIS PAGE TO A FRIEND

SMAD3

SMAD family member 3

Synonyms: HSPC193 HsT17436 JV15-2 LDS1C LDS3 MADH3
Gene ID:
Human(4088) Summary: The protein encoded by this gene belongs to the SMAD, a family of proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein functions as a transcriptional modulator activated by transforming growth factor-beta and is thought to play a role in the regulation of carcinogenesis. [provided by RefSeq, Apr 2009]
Mouse(17127) SMAD family member 3
Rat(25631) SMAD family member 3
cow(515125) SMAD family member 3
sheep(443169) SMAD family member 3
domestic guinea pig(100731807) SMAD family member 3
naked mole-rat(101713378) SMAD family member 3
chicken(395132) SMAD family member 3
Horse(100033845) SMAD family member 3
domestic cat(101101387) SMAD family member 3
dog(610902) SMAD family member 3
104 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4504208 Anti-phospho-Smad2/3 (pThr8) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4504210 Anti-phospho-Smad3 (pSer204) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4301416 Anti-phospho-Smad3 (pSer204) antibody produced in rabbit affinity isolated antibody human, mouse
western blot pricing
SAB4504211 Anti-phospho-Smad3 (pSer208) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4301571 Anti-phospho-Smad3 (pSer208) antibody produced in rabbit affinity isolated antibody mouse, rat, human
western blot pricing
SAB4504212 Anti-phospho-Smad3 (pSer213) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4301417 Anti-phospho-Smad3 (pSer213) antibody produced in rabbit affinity isolated antibody human, mouse, rat
western blot pricing
SAB4503781 Anti-phospho-Smad3 (pSer425) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4300253 Anti-phospho-SMAD3 (pSer425) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunohistochemistry pricing
SAB4504209 Anti-phospho-Smad3 (pThr179) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4301453 Anti-phospho-Smad3 (pThr179) antibody produced in rabbit affinity isolated antibody human, mouse, rat
western blot pricing
SAB4501809 Anti-SMAD2, N-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4300564 Anti-SMAD3 (Ab-208) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunofluorescence, immunohistochemistry pricing
SAB4300565 Anti-SMAD3 (Ab-425) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunofluorescence, immunohistochemistry pricing
AV100621 Anti-SMAD3 antibody produced in rabbit IgG fraction of antiserum human, canine, rat, guinea pig, mouse, zebrafish
immunohistochemistry, western blot pricing
SAB4200342 Anti-SMAD3 antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody rat, human, mouse
western blot pricing
SAB2702052 Anti-SMAD3 antibody produced in rabbit human
ChIP, immunocytochemistry, immunofluorescence, immunohistochemistry, immunoprecipitation, western blot pricing
SAB4501811 Anti-SMAD3 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4501812 Anti-SMAD3 antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry, western blot pricing
SAB4501813 Anti-SMAD3 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
HPA046386 Anti-SMAD3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
HPA067203 Anti-SMAD3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunohistochemistry, western blot pricing
SAB4501810 Anti-SMAD3, C-Terminal antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry, western blot pricing
WH0004088M1 Monoclonal Anti-SMAD3 antibody produced in mouse clone 2C12, purified immunoglobulin, buffered aqueous solution rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
WH0004088M5 Monoclonal Anti-SMAD3 antibody produced in mouse clone 4D5, purified immunoglobulin, buffered aqueous solution mouse, rat, human
ELISA, western blot pricing
SAB1400160 Monoclonal Anti-SMAD3 antibody produced in mouse clone 7F3, purified immunoglobulin, buffered aqueous solution human, rat
ELISA, immunohistochemistry, western blot pricing
SAB1404037 Monoclonal Anti-SMAD3 antibody produced in mouse clone 4F9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016769 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016769 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016769 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005902 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005902 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005902 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005902 Rosetta Predictions human pricing
NM_013095 Rosetta Predictions rat pricing
NM_016769 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005902 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208931 predicted 621
2 SASI_Hs02_00340511 predicted 894
3 SASI_Hs01_00208932 predicted 1216
4 SASI_Hs01_00208933 predicted 1831
5 SASI_Hs02_00340512 predicted 1556
6 SASI_Hs01_00208934 predicted 1499
7 SASI_Hs01_00208935 predicted 1310
8 SASI_Hs01_00208936 predicted 1449
9 SASI_Hs01_00208937 predicted 1367
10 SASI_Hs01_00208938 predicted 1059
11 SASI_Hs01_00208930 predicted 1742
12 SASI_Hs01_00208939 predicted 691
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013095 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260862 predicted 550
2 SASI_Rn01_00100662 predicted 1277
3 SASI_Rn01_00100663 predicted 1239
4 SASI_Rn02_00260863 predicted 1572
5 SASI_Rn01_00100664 predicted 1486
6 SASI_Rn01_00100665 predicted 298
7 SASI_Rn01_00100666 predicted 843
8 SASI_Rn01_00100667 predicted 604
9 SASI_Rn01_00100668 predicted 1466
10 SASI_Rn01_00100670 predicted 1045
11 SASI_Rn01_00100669 predicted 971
12 SASI_Rn01_00100671 predicted 567
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016769 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323533 predicted 641
2 SASI_Mm01_00153031 predicted 664
3 SASI_Mm01_00153032 predicted 712
4 SASI_Mm01_00153033 predicted 410
5 SASI_Mm01_00153034 predicted 1584
6 SASI_Mm01_00153035 predicted 1081
7 SASI_Mm02_00323534 predicted 1218
8 SASI_Mm01_00153036 predicted 955
9 SASI_Mm01_00153037 predicted 1587
10 SASI_Mm01_00153038 predicted 720
11 SASI_Mm01_00153029 predicted 642
12 SASI_Mm01_00153030 predicted 1356
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016769
VALIDATED
SMAD3 MISSION shRNA Bacterial Glycerol Stock
SMAD family member 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016769.2-960s1c1
Sequence:CCGGGCACACAATAACTTGGACCTACTCGAGTAGGTCCAAGTTATTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016769.2-1430s1c1
Sequence:CCGGCATCCGTATGAGCTTCGTCAACTCGAGTTGACGAAGCTCATACGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016769.2-2793s1c1
Sequence:CCGGCCCATGTTTCTGCATGGATTTCTCGAGAAATCCATGCAGAAACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016769.2-687s1c1
Sequence:CCGGCCTTACCACTATCAGAGAGTACTCGAGTACTCTCTGATAGTGGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016769.2-1137s1c1
Sequence:CCGGCTGTCCAATGTCAACCGGAATCTCGAGATTCCGGTTGACATTGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016769.3-493s21c1
Sequence:CCGGACGTGAACACCAAGTGCATTACTCGAGTAATGCACTTGGTGTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016769.3-1432s21c1
Sequence:CCGGTCCGTATGAGCTTCGTCAAAGCTCGAGCTTTGACGAAGCTCATACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016769.3-1592s21c1
Sequence:CCGGTTAGAGACACTAGGAGTAAAGCTCGAGCTTTACTCCTAGTGTCTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016769.3-1690s21c1
Sequence:CCGGCACCGATTCCACTCAACTAAGCTCGAGCTTAGTTGAGTGGAATCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016769.3-1137s21c1
Sequence:CCGGCTGTCCAATGTCAACCGGAATCTCGAGATTCCGGTTGACATTGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016769
VALIDATED
SMAD3 MISSION shRNA shRNA Plasmid DNA
SMAD family member 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016769.2-960s1c1
Sequence:CCGGGCACACAATAACTTGGACCTACTCGAGTAGGTCCAAGTTATTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016769.2-1430s1c1
Sequence:CCGGCATCCGTATGAGCTTCGTCAACTCGAGTTGACGAAGCTCATACGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016769.2-2793s1c1
Sequence:CCGGCCCATGTTTCTGCATGGATTTCTCGAGAAATCCATGCAGAAACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016769.2-687s1c1
Sequence:CCGGCCTTACCACTATCAGAGAGTACTCGAGTACTCTCTGATAGTGGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016769.2-1137s1c1
Sequence:CCGGCTGTCCAATGTCAACCGGAATCTCGAGATTCCGGTTGACATTGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016769.3-493s21c1
Sequence:CCGGACGTGAACACCAAGTGCATTACTCGAGTAATGCACTTGGTGTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016769.3-1432s21c1
Sequence:CCGGTCCGTATGAGCTTCGTCAAAGCTCGAGCTTTGACGAAGCTCATACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016769.3-1592s21c1
Sequence:CCGGTTAGAGACACTAGGAGTAAAGCTCGAGCTTTACTCCTAGTGTCTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016769.3-1690s21c1
Sequence:CCGGCACCGATTCCACTCAACTAAGCTCGAGCTTAGTTGAGTGGAATCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016769.3-1137s21c1
Sequence:CCGGCTGTCCAATGTCAACCGGAATCTCGAGATTCCGGTTGACATTGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016769
VALIDATED
SMAD3 MISSION shRNA Lentiviral Transduction Particles
SMAD family member 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016769.2-960s1c1
Sequence:CCGGGCACACAATAACTTGGACCTACTCGAGTAGGTCCAAGTTATTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016769.2-1430s1c1
Sequence:CCGGCATCCGTATGAGCTTCGTCAACTCGAGTTGACGAAGCTCATACGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016769.2-2793s1c1
Sequence:CCGGCCCATGTTTCTGCATGGATTTCTCGAGAAATCCATGCAGAAACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016769.2-687s1c1
Sequence:CCGGCCTTACCACTATCAGAGAGTACTCGAGTACTCTCTGATAGTGGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016769.2-1137s1c1
Sequence:CCGGCTGTCCAATGTCAACCGGAATCTCGAGATTCCGGTTGACATTGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016769.3-493s21c1
Sequence:CCGGACGTGAACACCAAGTGCATTACTCGAGTAATGCACTTGGTGTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016769.3-1432s21c1
Sequence:CCGGTCCGTATGAGCTTCGTCAAAGCTCGAGCTTTGACGAAGCTCATACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016769.3-1592s21c1
Sequence:CCGGTTAGAGACACTAGGAGTAAAGCTCGAGCTTTACTCCTAGTGTCTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016769.3-1690s21c1
Sequence:CCGGCACCGATTCCACTCAACTAAGCTCGAGCTTAGTTGAGTGGAATCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016769.3-1137s21c1
Sequence:CCGGCTGTCCAATGTCAACCGGAATCTCGAGATTCCGGTTGACATTGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005902
VALIDATED
SMAD3 MISSION shRNA Bacterial Glycerol Stock
SMAD family member 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005902.2-538s1c1
Sequence:CCGGCTGTGTGAGTTCGCCTTCAATCTCGAGATTGAAGGCGAACTCACACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005902.2-918s1c1
Sequence:CCGGCATCTCCTACTACGAGCTGAACTCGAGTTCAGCTCGTAGTAGGAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005902.2-324s1c1
Sequence:CCGGGAGCCTGGTCAAGAAACTCAACTCGAGTTGAGTTTCTTGACCAGGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005902.2-1473s1c1
Sequence:CCGGCCGCTGTTCCAGTGTGTCTTACTCGAGTAAGACACACTGGAACAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005902.2-855s1c1
Sequence:CCGGCCCAGCACATAATAACTTGGACTCGAGTCCAAGTTATTATGTGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005902.3-1413s21c1
Sequence:CCGGTCCGCATGAGCTTCGTCAAAGCTCGAGCTTTGACGAAGCTCATGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_005902.3-406s21c1
Sequence:CCGGGAGCCTGGTCAAGAAACTCAACTCGAGTTGAGTTTCTTGACCAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_005902.3-1482s21c1
Sequence:CCGGGGATTGAGCTGCACCTGAATGCTCGAGCATTCAGGTGCAGCTCAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_005902.3-1218s21c1
Sequence:CCGGGCCTCAGTGACAGCGCTATTTCTCGAGAAATAGCGCTGTCACTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330128    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_005902.3-1839s21c1
Sequence:CCGGTGAGCAGAACAGGTAGTATTACTCGAGTAATACTACCTGTTCTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005902
VALIDATED
SMAD3 MISSION shRNA shRNA Plasmid DNA
SMAD family member 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005902.2-538s1c1
Sequence:CCGGCTGTGTGAGTTCGCCTTCAATCTCGAGATTGAAGGCGAACTCACACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005902.2-918s1c1
Sequence:CCGGCATCTCCTACTACGAGCTGAACTCGAGTTCAGCTCGTAGTAGGAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005902.2-324s1c1
Sequence:CCGGGAGCCTGGTCAAGAAACTCAACTCGAGTTGAGTTTCTTGACCAGGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005902.2-1473s1c1
Sequence:CCGGCCGCTGTTCCAGTGTGTCTTACTCGAGTAAGACACACTGGAACAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005902.2-855s1c1
Sequence:CCGGCCCAGCACATAATAACTTGGACTCGAGTCCAAGTTATTATGTGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005902.3-1413s21c1
Sequence:CCGGTCCGCATGAGCTTCGTCAAAGCTCGAGCTTTGACGAAGCTCATGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_005902.3-406s21c1
Sequence:CCGGGAGCCTGGTCAAGAAACTCAACTCGAGTTGAGTTTCTTGACCAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_005902.3-1482s21c1
Sequence:CCGGGGATTGAGCTGCACCTGAATGCTCGAGCATTCAGGTGCAGCTCAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_005902.3-1218s21c1
Sequence:CCGGGCCTCAGTGACAGCGCTATTTCTCGAGAAATAGCGCTGTCACTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330128    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_005902.3-1839s21c1
Sequence:CCGGTGAGCAGAACAGGTAGTATTACTCGAGTAATACTACCTGTTCTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005902
VALIDATED
SMAD3 MISSION shRNA Lentiviral Transduction Particles
SMAD family member 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005902.2-538s1c1
Sequence:CCGGCTGTGTGAGTTCGCCTTCAATCTCGAGATTGAAGGCGAACTCACACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005902.2-918s1c1
Sequence:CCGGCATCTCCTACTACGAGCTGAACTCGAGTTCAGCTCGTAGTAGGAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005902.2-324s1c1
Sequence:CCGGGAGCCTGGTCAAGAAACTCAACTCGAGTTGAGTTTCTTGACCAGGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005902.2-1473s1c1
Sequence:CCGGCCGCTGTTCCAGTGTGTCTTACTCGAGTAAGACACACTGGAACAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005902.2-855s1c1
Sequence:CCGGCCCAGCACATAATAACTTGGACTCGAGTCCAAGTTATTATGTGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005902.3-1413s21c1
Sequence:CCGGTCCGCATGAGCTTCGTCAAAGCTCGAGCTTTGACGAAGCTCATGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_005902.3-406s21c1
Sequence:CCGGGAGCCTGGTCAAGAAACTCAACTCGAGTTGAGTTTCTTGACCAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_005902.3-1482s21c1
Sequence:CCGGGGATTGAGCTGCACCTGAATGCTCGAGCATTCAGGTGCAGCTCAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_005902.3-1218s21c1
Sequence:CCGGGCCTCAGTGACAGCGCTATTTCTCGAGAAATAGCGCTGTCACTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330128    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_005902.3-1839s21c1
Sequence:CCGGTGAGCAGAACAGGTAGTATTACTCGAGTAATACTACCTGTTCTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks