EMAIL THIS PAGE TO A FRIEND

SMARCA2

SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2

Synonyms: BAF190 BRM NCBRS SNF2 SNF2L2 SNF2LA SWI2 Sth1p hBRM hSNF2a
UniProtKB ID: P51531, B1ALG3, B1ALG4, D3DRH4, D3DRH5
Gene ID:
Human(6595) Summary: The protein encoded by this gene is a member of the SWI/SNF family of proteins and is highly similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. Two transcript variants encoding different isoforms have been found for this gene, which contains a trinucleotide repeat (CAG) length polymorphism. [provided by RefSeq, Jul 2008]
Mouse(67155) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
Rat(361745) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
cow(540904) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
sheep(101110736) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
domestic guinea pig(100722639) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
Domestic Rabbit(100338619) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
naked mole-rat(101706423) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
Zebrafish(334032) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
chicken(396040) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
domestic cat(101083118) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
Horse(100058279) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
dog(476335) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
153 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011416 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011416 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011416 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003070 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003070 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003070 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003070 Rosetta Predictions human pricing
NM_139045 Rosetta Predictions human pricing
NM_001004446 Rosetta Predictions rat pricing
NM_011416 Rosetta Predictions mouse pricing
NM_026003 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003070 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113587 predicted 2322
2 SASI_Hs01_00113588 predicted 3818
3 SASI_Hs02_00334987 predicted 2455
4 SASI_Hs01_00113589 predicted 3227
5 SASI_Hs02_00334988 predicted 2568
6 SASI_Hs01_00113590 predicted 1443
7 SASI_Hs01_00113592 predicted 2851
8 SASI_Hs01_00113593 predicted 2295
9 SASI_Hs01_00113594 predicted 4929
10 SASI_Hs02_00334989 predicted 3943
11 SASI_Hs01_00113591 predicted 2135
12 SASI_Hs01_00113595 predicted 2369
13 SASI_Hs01_00113596 predicted 2847
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139045 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096854 predicted 2323
2 SASI_Hs01_00096855 predicted 3818
3 SASI_Hs02_00364094 predicted 2456
4 SASI_Hs01_00096856 predicted 3226
5 SASI_Hs02_00364095 predicted 2568
6 SASI_Hs01_00096857 predicted 1441
7 SASI_Hs01_00096859 predicted 2859
8 SASI_Hs01_00096860 predicted 2289
9 SASI_Hs01_00096861 predicted 4874
10 SASI_Hs02_00364096 predicted 3942
11 SASI_Hs01_00096858 predicted 2125
12 SASI_Hs01_00096862 predicted 2378
13 SASI_Hs01_00096863 predicted 2844
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004446 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059484 predicted 2197
2 SASI_Rn01_00059485 predicted 2868
3 SASI_Rn01_00059486 predicted 2517
4 SASI_Rn01_00059487 predicted 1516
5 SASI_Rn02_00198350 predicted 3904
6 SASI_Rn01_00059488 predicted 2649
7 SASI_Rn01_00059489 predicted 3204
8 SASI_Rn01_00059490 predicted 2898
9 SASI_Rn01_00059491 predicted 3743
10 SASI_Rn02_00198351 predicted 3318
11 SASI_Rn01_00059492 predicted 2619
12 SASI_Rn01_00059493 predicted 2162
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011416 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196787 predicted 4354
2 SASI_Mm01_00196788 predicted 4388
3 SASI_Mm01_00196789 predicted 4347
4 SASI_Mm01_00196790 predicted 4341
5 SASI_Mm01_00196791 predicted 4353
6 SASI_Mm01_00196792 predicted 4382
7 SASI_Mm01_00196793 predicted 4343
8 SASI_Mm01_00196794 predicted 4348
9 SASI_Mm01_00196795 predicted 4328
10 SASI_Mm01_00196796 predicted 4337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026003 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020306 predicted 542
2 SASI_Mm01_00020307 predicted 902
3 SASI_Mm01_00020309 predicted 539
4 SASI_Mm01_00020310 predicted 702
5 SASI_Mm01_00020311 predicted 962
6 SASI_Mm01_00020312 predicted 956
7 SASI_Mm01_00020313 predicted 692
8 SASI_Mm01_00020314 predicted 712
9 SASI_Mm01_00020315 predicted 665
10 SASI_Mm02_00329464 predicted 598
11 SASI_Mm01_00020308 predicted 541
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011416
VALIDATED
SMARCA2 MISSION shRNA Bacterial Glycerol Stock
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071398    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011416.2-5133s1c1
Sequence:CCGGGCCTCAAAGATTCAAAGATTACTCGAGTAATCTTTGAATCTTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011416.2-2621s1c1
Sequence:CCGGCCTGACTACTTACGAGTACATCTCGAGATGTACTCGTAAGTAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011416.2-3320s1c1
Sequence:CCGGGCCCAAATTGAGAGCGACTAACTCGAGTTAGTCGCTCTCAATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011416.2-4260s1c1
Sequence:CCGGGCTGAGAAGTTGTCACCAAATCTCGAGATTTGGTGACAACTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011416.2-4308s1c1
Sequence:CCGGGCCATCATTGATACTGTGATACTCGAGTATCACAGTATCAATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011416.2-4308s21c1
Sequence:CCGGGCCATCATTGATACTGTGATACTCGAGTATCACAGTATCAATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011416.2-4260s21c1
Sequence:CCGGGCTGAGAAGTTGTCACCAAATCTCGAGATTTGGTGACAACTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011416.2-3320s21c1
Sequence:CCGGGCCCAAATTGAGAGCGACTAACTCGAGTTAGTCGCTCTCAATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011416.2-5133s21c1
Sequence:CCGGGCCTCAAAGATTCAAAGATTACTCGAGTAATCTTTGAATCTTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011416
VALIDATED
SMARCA2 MISSION shRNA shRNA Plasmid DNA
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071398    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011416.2-5133s1c1
Sequence:CCGGGCCTCAAAGATTCAAAGATTACTCGAGTAATCTTTGAATCTTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011416.2-2621s1c1
Sequence:CCGGCCTGACTACTTACGAGTACATCTCGAGATGTACTCGTAAGTAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011416.2-3320s1c1
Sequence:CCGGGCCCAAATTGAGAGCGACTAACTCGAGTTAGTCGCTCTCAATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011416.2-4260s1c1
Sequence:CCGGGCTGAGAAGTTGTCACCAAATCTCGAGATTTGGTGACAACTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011416.2-4308s1c1
Sequence:CCGGGCCATCATTGATACTGTGATACTCGAGTATCACAGTATCAATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011416.2-4308s21c1
Sequence:CCGGGCCATCATTGATACTGTGATACTCGAGTATCACAGTATCAATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011416.2-4260s21c1
Sequence:CCGGGCTGAGAAGTTGTCACCAAATCTCGAGATTTGGTGACAACTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011416.2-3320s21c1
Sequence:CCGGGCCCAAATTGAGAGCGACTAACTCGAGTTAGTCGCTCTCAATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011416.2-5133s21c1
Sequence:CCGGGCCTCAAAGATTCAAAGATTACTCGAGTAATCTTTGAATCTTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011416
VALIDATED
SMARCA2 MISSION shRNA Lentiviral Transduction Particles
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071398    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011416.2-5133s1c1
Sequence:CCGGGCCTCAAAGATTCAAAGATTACTCGAGTAATCTTTGAATCTTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011416.2-2621s1c1
Sequence:CCGGCCTGACTACTTACGAGTACATCTCGAGATGTACTCGTAAGTAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011416.2-3320s1c1
Sequence:CCGGGCCCAAATTGAGAGCGACTAACTCGAGTTAGTCGCTCTCAATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011416.2-4260s1c1
Sequence:CCGGGCTGAGAAGTTGTCACCAAATCTCGAGATTTGGTGACAACTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011416.2-4308s1c1
Sequence:CCGGGCCATCATTGATACTGTGATACTCGAGTATCACAGTATCAATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011416.2-4308s21c1
Sequence:CCGGGCCATCATTGATACTGTGATACTCGAGTATCACAGTATCAATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011416.2-4260s21c1
Sequence:CCGGGCTGAGAAGTTGTCACCAAATCTCGAGATTTGGTGACAACTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011416.2-3320s21c1
Sequence:CCGGGCCCAAATTGAGAGCGACTAACTCGAGTTAGTCGCTCTCAATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011416.2-5133s21c1
Sequence:CCGGGCCTCAAAGATTCAAAGATTACTCGAGTAATCTTTGAATCTTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003070
VALIDATED
SMARCA2 MISSION shRNA Bacterial Glycerol Stock
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003070.2-4204s1c1
Sequence:CCGGGCTGAGAAACTGTCACCAAATCTCGAGATTTGGTGACAGTTTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_003070.2-2319s1c1
Sequence:CCGGCGGAATCTTAGCCGATGAAATCTCGAGATTTCATCGGCTAAGATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003070.2-1192s1c1
Sequence:CCGGCCACCAGATTTAAGAACCAAACTCGAGTTTGGTTCTTAAATCTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003070.2-4775s1c1
Sequence:CCGGCCAAACCTGTAGTGAGCGATTCTCGAGAATCGCTCACTACAGGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367881    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003070.3-5153s21c1
Sequence:CCGGTTCTATGGGTGGGTCTAATTTCTCGAGAAATTAGACCCACCCATAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003070.3-4216s21c1
Sequence:CCGGGCTGAGAAACTGTCACCAAATCTCGAGATTTGGTGACAGTTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330445    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003070.3-4971s21c1
Sequence:CCGGCTATATCATCATCGTCTATAACTCGAGTTATAGACGATGATGATATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_003070.3-2906s21c1
Sequence:CCGGGGCGTCTACATAAGGTGTTAACTCGAGTTAACACCTTATGTAGACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003070.3-4787s21c1
Sequence:CCGGCCAAACCTGTAGTGAGCGATTCTCGAGAATCGCTCACTACAGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_003070.3-3335s21c1
Sequence:CCGGTGACCATCATGGAGGATTATTCTCGAGAATAATCCTCCATGATGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003070.3-4080s21c1
Sequence:CCGGGGCCATCGAAGACGGCAATTTCTCGAGAAATTGCCGTCTTCGATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003070
VALIDATED
SMARCA2 MISSION shRNA shRNA Plasmid DNA
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003070.2-4204s1c1
Sequence:CCGGGCTGAGAAACTGTCACCAAATCTCGAGATTTGGTGACAGTTTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_003070.2-2319s1c1
Sequence:CCGGCGGAATCTTAGCCGATGAAATCTCGAGATTTCATCGGCTAAGATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003070.2-1192s1c1
Sequence:CCGGCCACCAGATTTAAGAACCAAACTCGAGTTTGGTTCTTAAATCTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003070.2-4775s1c1
Sequence:CCGGCCAAACCTGTAGTGAGCGATTCTCGAGAATCGCTCACTACAGGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367881    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003070.3-5153s21c1
Sequence:CCGGTTCTATGGGTGGGTCTAATTTCTCGAGAAATTAGACCCACCCATAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003070.3-4216s21c1
Sequence:CCGGGCTGAGAAACTGTCACCAAATCTCGAGATTTGGTGACAGTTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330445    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003070.3-4971s21c1
Sequence:CCGGCTATATCATCATCGTCTATAACTCGAGTTATAGACGATGATGATATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_003070.3-2906s21c1
Sequence:CCGGGGCGTCTACATAAGGTGTTAACTCGAGTTAACACCTTATGTAGACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003070.3-4787s21c1
Sequence:CCGGCCAAACCTGTAGTGAGCGATTCTCGAGAATCGCTCACTACAGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_003070.3-3335s21c1
Sequence:CCGGTGACCATCATGGAGGATTATTCTCGAGAATAATCCTCCATGATGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003070.3-4080s21c1
Sequence:CCGGGGCCATCGAAGACGGCAATTTCTCGAGAAATTGCCGTCTTCGATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003070
VALIDATED
SMARCA2 MISSION shRNA Lentiviral Transduction Particles
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003070.2-4204s1c1
Sequence:CCGGGCTGAGAAACTGTCACCAAATCTCGAGATTTGGTGACAGTTTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_003070.2-2319s1c1
Sequence:CCGGCGGAATCTTAGCCGATGAAATCTCGAGATTTCATCGGCTAAGATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003070.2-1192s1c1
Sequence:CCGGCCACCAGATTTAAGAACCAAACTCGAGTTTGGTTCTTAAATCTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003070.2-4775s1c1
Sequence:CCGGCCAAACCTGTAGTGAGCGATTCTCGAGAATCGCTCACTACAGGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367881    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003070.3-5153s21c1
Sequence:CCGGTTCTATGGGTGGGTCTAATTTCTCGAGAAATTAGACCCACCCATAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003070.3-4216s21c1
Sequence:CCGGGCTGAGAAACTGTCACCAAATCTCGAGATTTGGTGACAGTTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330445    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003070.3-4971s21c1
Sequence:CCGGCTATATCATCATCGTCTATAACTCGAGTTATAGACGATGATGATATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_003070.3-2906s21c1
Sequence:CCGGGGCGTCTACATAAGGTGTTAACTCGAGTTAACACCTTATGTAGACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003070.3-4787s21c1
Sequence:CCGGCCAAACCTGTAGTGAGCGATTCTCGAGAATCGCTCACTACAGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_003070.3-3335s21c1
Sequence:CCGGTGACCATCATGGAGGATTATTCTCGAGAATAATCCTCCATGATGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003070.3-4080s21c1
Sequence:CCGGGGCCATCGAAGACGGCAATTTCTCGAGAAATTGCCGTCTTCGATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks