EMAIL THIS PAGE TO A FRIEND

SMARCA4

SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4

Synonyms: BAF190 BAF190A BRG1 MRD16 RTPS2 SNF2 SNF2L4 SNF2LB SWI2 hSNF2b
Gene ID:
Human(6597) Summary: The protein encoded by this gene is a member of the SWI/SNF family of proteins and is similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. In addition, this protein can bind BRCA1, as well as regulate the expression of the tumorigenic protein CD44. Mutations in this gene cause rhabdoid tumor predisposition syndrome type 2. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
Mouse(20586) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4
Rat(171379) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4
Zebrafish(353295) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4
domestic cat(101097046) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4
dog(476710) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4
chicken(395932) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4
naked mole-rat(101700987) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4
domestic guinea pig(100719729) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4
cow(414274) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4
sheep(101116565) SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4
Gene Class: ATPase
99 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
B8184 Anti-Brg1/hSNF2β antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, microarray, western blot pricing
SAB4300714 Anti-SMARCA4 antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4300727 Anti-SMARCA4 antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry, western blot pricing
PLA0301 Goat anti-BRG1/SMARCA4 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. mouse, human
immunoprecipitation, proximity ligation assay, western blot pricing
SAB4200195 Monoclonal Anti-Brg1 antibody produced in rat ~1.0 mg/mL, clone 5B7, purified immunoglobulin monkey, mouse, human
ChIP, immunocytochemistry, immunoprecipitation, western blot pricing
SAB4200641 Monoclonal Anti-Brg1 antibody produced in rat clone 3G4, purified from hybridoma cell culture mouse, human
flow cytometry, immunofluorescence, western blot pricing
PLA0146 Rabbit anti-BRG1/SMARCA4 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. rhesus monkey, chimpanzee, horse, rabbit, mouse, dog, gorilla, human, primate, marmoset
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003072 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003072 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003072 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011417 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011417 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011417 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU076601 MISSION® esiRNA esiRNA human SMARCA4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003072 Rosetta Predictions human pricing
XM_001073453 Rosetta Predictions rat pricing
XM_343358 Rosetta Predictions rat pricing
NM_011417 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003072 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019362 predicted 1693
2 SASI_Hs01_00019364 predicted 4740
3 SASI_Hs01_00019365 predicted 3510
4 SASI_Hs02_00334991 predicted 2530
5 SASI_Hs01_00019366 predicted 3254
6 SASI_Hs01_00019367 predicted 1730
7 SASI_Hs01_00019368 predicted 3385
8 SASI_Hs01_00019369 predicted 2546
9 SASI_Hs01_00019370 predicted 3714
10 SASI_Hs01_00019371 predicted 2852
11 SASI_Hs01_00019363 predicted 1734
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073453 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342896 predicted 813
2 SASI_Rn02_00342897 predicted 3917
3 SASI_Rn02_00342898 predicted 3411
4 SASI_Rn02_00342899 predicted 3490
5 SASI_Rn02_00342900 predicted 2877
6 SASI_Rn02_00342901 predicted 5286
7 SASI_Rn02_00342902 predicted 528
8 SASI_Rn02_00342903 predicted 3426
9 SASI_Rn02_00342904 predicted 3157
10 SASI_Rn02_00342905 predicted 2938
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343358 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395683 predicted 815
2 SASI_Rn02_00395684 predicted 3916
3 SASI_Rn02_00395685 predicted 3417
4 SASI_Rn02_00395686 predicted 3490
5 SASI_Rn02_00395687 predicted 2874
6 SASI_Rn02_00395688 predicted 5291
7 SASI_Rn02_00395689 predicted 531
8 SASI_Rn02_00395690 predicted 3426
9 SASI_Rn02_00395691 predicted 3156
10 SASI_Rn02_00395692 predicted 2938
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011417 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045894 predicted 1161
2 SASI_Mm01_00045895 predicted 1395
3 SASI_Mm01_00045896 predicted 2527
4 SASI_Mm01_00045897 predicted 2815
5 SASI_Mm01_00045898 predicted 4044
6 SASI_Mm01_00045899 predicted 3480
7 SASI_Mm02_00320635 predicted 2833
8 SASI_Mm01_00045900 predicted 5178
9 SASI_Mm01_00045902 predicted 4389
10 SASI_Mm01_00045903 predicted 2930
11 SASI_Mm01_00045901 predicted 3775
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003072
SMARCA4 MISSION shRNA Bacterial Glycerol Stock
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003072.3-3096s21c1
Sequence:GTACCGGACCTTCGAGCAGTGGTTTAACCTCGAGGTTAAACCACTGCTCGAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003072.3-2545s21c1
Sequence:GTACCGGTCAAACAGTACCAGATCAAAGCTCGAGCTTTGATCTGGTACTGTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003072.3-3629s21c1
Sequence:CCGGCTTTGCGTATCGCGGCTTTAACTCGAGTTAAAGCCGCGATACGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003072.3-3509s21c1
Sequence:CCGGGTACCGAGCCTCGGGTAAATTCTCGAGAATTTACCCGAGGCTCGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003072.3-2510s21c1
Sequence:CCGGGGACAAGCAGTCAGCGCTTATCTCGAGATAAGCGCTGACTGCTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003072.3-5279s21c1
Sequence:CCGGGGCATAGGCCTTAGCAGTAACCTCGAGGTTACTGCTAAGGCCTATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003072.3-2674s21c1
Sequence:GTACCGGTGGAGCACAAACGCATCAATGCTCGAGCATTGATGCGTTTGTGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003072.3-2418s21c1
Sequence:GTACCGGCAAGATGTCGATGATGAATATCTCGAGATATTCATCATCGACATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003072.3-2860s21c1
Sequence:GTACCGGCGTACGAGTACATCATCAAAGCTCGAGCTTTGATGATGTACTCGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003072.2-5350s1c1
Sequence:CCGGCCATATTTATACAGCAGAGAACTCGAGTTCTCTGCTGTATAAATATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003072.2-2233s1c1
Sequence:CCGGCCGAGGTCTGATAGTGAAGAACTCGAGTTCTTCACTATCAGACCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003072.2-3776s1c1
Sequence:CCGGCGGCAGACACTGTGATCATTTCTCGAGAAATGATCACAGTGTCTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003072
SMARCA4 MISSION shRNA shRNA Plasmid DNA
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003072.3-3096s21c1
Sequence:GTACCGGACCTTCGAGCAGTGGTTTAACCTCGAGGTTAAACCACTGCTCGAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003072.3-2545s21c1
Sequence:GTACCGGTCAAACAGTACCAGATCAAAGCTCGAGCTTTGATCTGGTACTGTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003072.3-3629s21c1
Sequence:CCGGCTTTGCGTATCGCGGCTTTAACTCGAGTTAAAGCCGCGATACGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003072.3-3509s21c1
Sequence:CCGGGTACCGAGCCTCGGGTAAATTCTCGAGAATTTACCCGAGGCTCGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003072.3-2510s21c1
Sequence:CCGGGGACAAGCAGTCAGCGCTTATCTCGAGATAAGCGCTGACTGCTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003072.3-5279s21c1
Sequence:CCGGGGCATAGGCCTTAGCAGTAACCTCGAGGTTACTGCTAAGGCCTATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003072.3-2674s21c1
Sequence:GTACCGGTGGAGCACAAACGCATCAATGCTCGAGCATTGATGCGTTTGTGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003072.3-2418s21c1
Sequence:GTACCGGCAAGATGTCGATGATGAATATCTCGAGATATTCATCATCGACATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003072.3-2860s21c1
Sequence:GTACCGGCGTACGAGTACATCATCAAAGCTCGAGCTTTGATGATGTACTCGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003072.2-5350s1c1
Sequence:CCGGCCATATTTATACAGCAGAGAACTCGAGTTCTCTGCTGTATAAATATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003072.2-2233s1c1
Sequence:CCGGCCGAGGTCTGATAGTGAAGAACTCGAGTTCTTCACTATCAGACCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003072.2-3776s1c1
Sequence:CCGGCGGCAGACACTGTGATCATTTCTCGAGAAATGATCACAGTGTCTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003072
SMARCA4 MISSION shRNA Lentiviral Transduction Particles
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003072.3-3096s21c1
Sequence:GTACCGGACCTTCGAGCAGTGGTTTAACCTCGAGGTTAAACCACTGCTCGAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003072.3-2545s21c1
Sequence:GTACCGGTCAAACAGTACCAGATCAAAGCTCGAGCTTTGATCTGGTACTGTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003072.3-3629s21c1
Sequence:CCGGCTTTGCGTATCGCGGCTTTAACTCGAGTTAAAGCCGCGATACGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003072.3-3509s21c1
Sequence:CCGGGTACCGAGCCTCGGGTAAATTCTCGAGAATTTACCCGAGGCTCGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003072.3-2510s21c1
Sequence:CCGGGGACAAGCAGTCAGCGCTTATCTCGAGATAAGCGCTGACTGCTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003072.3-5279s21c1
Sequence:CCGGGGCATAGGCCTTAGCAGTAACCTCGAGGTTACTGCTAAGGCCTATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003072.3-2674s21c1
Sequence:GTACCGGTGGAGCACAAACGCATCAATGCTCGAGCATTGATGCGTTTGTGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003072.3-2418s21c1
Sequence:GTACCGGCAAGATGTCGATGATGAATATCTCGAGATATTCATCATCGACATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003072.3-2860s21c1
Sequence:GTACCGGCGTACGAGTACATCATCAAAGCTCGAGCTTTGATGATGTACTCGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003072.2-5350s1c1
Sequence:CCGGCCATATTTATACAGCAGAGAACTCGAGTTCTCTGCTGTATAAATATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003072.2-2233s1c1
Sequence:CCGGCCGAGGTCTGATAGTGAAGAACTCGAGTTCTTCACTATCAGACCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003072.2-3776s1c1
Sequence:CCGGCGGCAGACACTGTGATCATTTCTCGAGAAATGATCACAGTGTCTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011417
VALIDATED
SMARCA4 MISSION shRNA Bacterial Glycerol Stock
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000288075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011417.2-4088s21c1
Sequence:CCGGCGAAGAAGAGTTTGACCTCTTCTCGAGAAGAGGTCAAACTCTTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011417.2-3195s21c1
Sequence:CCGGCGGCTCAAGAAGGAAGTTGAACTCGAGTTCAACTTCCTTCTTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011417.2-2366s21c1
Sequence:CCGGCGCCCGACACATTATTGAGAACTCGAGTTCTCAATAATGTGTCGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011417.2-5280s21c1
Sequence:CCGGTCGAGTCTCTACCAGCATTAACTCGAGTTAATGCTGGTAGAGACTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011417.2-3909s21c1
Sequence:CCGGGCTGCCAAATACAAACTCAATCTCGAGATTGAGTTTGTATTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011417.1-3803s1c1
Sequence:CCGGGCTGCCAAATACAAACTCAATCTCGAGATTGAGTTTGTATTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011417.1-415s1c1
Sequence:CCGGCCCACGATACAACCAGATGAACTCGAGTTCATCTGGTTGTATCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011417.1-3982s1c1
Sequence:CCGGCGAAGAAGAGTTTGACCTCTTCTCGAGAAGAGGTCAAACTCTTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011417.1-2260s1c1
Sequence:CCGGCGCCCGACACATTATTGAGAACTCGAGTTCTCAATAATGTGTCGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011417.1-3089s1c1
Sequence:CCGGCGGCTCAAGAAGGAAGTTGAACTCGAGTTCAACTTCCTTCTTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011417
VALIDATED
SMARCA4 MISSION shRNA shRNA Plasmid DNA
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000288075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011417.2-4088s21c1
Sequence:CCGGCGAAGAAGAGTTTGACCTCTTCTCGAGAAGAGGTCAAACTCTTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011417.2-3195s21c1
Sequence:CCGGCGGCTCAAGAAGGAAGTTGAACTCGAGTTCAACTTCCTTCTTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011417.2-2366s21c1
Sequence:CCGGCGCCCGACACATTATTGAGAACTCGAGTTCTCAATAATGTGTCGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011417.2-5280s21c1
Sequence:CCGGTCGAGTCTCTACCAGCATTAACTCGAGTTAATGCTGGTAGAGACTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011417.2-3909s21c1
Sequence:CCGGGCTGCCAAATACAAACTCAATCTCGAGATTGAGTTTGTATTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011417.1-3803s1c1
Sequence:CCGGGCTGCCAAATACAAACTCAATCTCGAGATTGAGTTTGTATTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011417.1-415s1c1
Sequence:CCGGCCCACGATACAACCAGATGAACTCGAGTTCATCTGGTTGTATCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011417.1-3982s1c1
Sequence:CCGGCGAAGAAGAGTTTGACCTCTTCTCGAGAAGAGGTCAAACTCTTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011417.1-2260s1c1
Sequence:CCGGCGCCCGACACATTATTGAGAACTCGAGTTCTCAATAATGTGTCGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011417.1-3089s1c1
Sequence:CCGGCGGCTCAAGAAGGAAGTTGAACTCGAGTTCAACTTCCTTCTTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011417
VALIDATED
SMARCA4 MISSION shRNA Lentiviral Transduction Particles
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000288075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011417.2-4088s21c1
Sequence:CCGGCGAAGAAGAGTTTGACCTCTTCTCGAGAAGAGGTCAAACTCTTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011417.2-3195s21c1
Sequence:CCGGCGGCTCAAGAAGGAAGTTGAACTCGAGTTCAACTTCCTTCTTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011417.2-2366s21c1
Sequence:CCGGCGCCCGACACATTATTGAGAACTCGAGTTCTCAATAATGTGTCGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011417.2-5280s21c1
Sequence:CCGGTCGAGTCTCTACCAGCATTAACTCGAGTTAATGCTGGTAGAGACTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011417.2-3909s21c1
Sequence:CCGGGCTGCCAAATACAAACTCAATCTCGAGATTGAGTTTGTATTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011417.1-3803s1c1
Sequence:CCGGGCTGCCAAATACAAACTCAATCTCGAGATTGAGTTTGTATTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011417.1-415s1c1
Sequence:CCGGCCCACGATACAACCAGATGAACTCGAGTTCATCTGGTTGTATCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011417.1-3982s1c1
Sequence:CCGGCGAAGAAGAGTTTGACCTCTTCTCGAGAAGAGGTCAAACTCTTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011417.1-2260s1c1
Sequence:CCGGCGCCCGACACATTATTGAGAACTCGAGTTCTCAATAATGTGTCGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011417.1-3089s1c1
Sequence:CCGGCGGCTCAAGAAGGAAGTTGAACTCGAGTTCAACTTCCTTCTTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks