EMAIL THIS PAGE TO A FRIEND

SMC3

structural maintenance of chromosomes 3

Synonyms: BAM BMH CDLS3 CSPG6 HCAP SMC3L1
UniProtKB ID: Q9UQE7, A8K156, O60464, Q5T482
Gene ID:
Human(9126) Summary: This gene belongs to the SMC3 subfamily of SMC proteins. The encoded protein occurs in certain cell types as either an intracellular, nuclear protein or a secreted protein. The nuclear form, known as structural maintenance of chromosomes 3, is a component of the multimeric cohesin complex that holds together sister chromatids during mitosis, enabling proper chromosome segregation. Post-translational modification of the encoded protein by the addition of chondroitin sulfate chains gives rise to the secreted proteoglycan bamacan, an abundant basement membrane protein. [provided by RefSeq, Jul 2008]
Mouse(13006) structural maintenance of chromosomes 3
Rat(29486) structural maintenance of chromosomes 3
Thale Cress(834917) structural maintenance of chromosomes protein 4
Zebrafish(324475) structural maintenance of chromosomes 3
chicken(395188) structural maintenance of chromosomes 3
domestic cat(101093211) structural maintenance of chromosomes 3
Horse(100059335) structural maintenance of chromosomes 3
dog(486886) structural maintenance of chromosomes 3
naked mole-rat(101725969) structural maintenance of chromosomes 3
Domestic Rabbit(100354309) structural maintenance of chromosomes 3
domestic guinea pig(100726965) structural maintenance of chromosomes 3
cow(281729) structural maintenance of chromosomes 3
sheep(101119007) structural maintenance of chromosomes 3
101 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1406782 Anti-CSPG6 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2701714 Anti-smc3 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
SAB2701720 Anti-smc3 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
AV47590 Anti-SMC3 antibody produced in rabbit affinity isolated antibody guinea pig, horse, rabbit, zebrafish, mouse, bovine, human, canine, rat,
immunohistochemistry, western blot pricing
HPA037411 Anti-SMC3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA043206 Anti-SMC3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB2105694 Anti-SMC3, (N-terminal) antibody produced in rabbit affinity isolated antibody human, horse, rabbit, guinea pig
western blot pricing
SAB1404676 Monoclonal Anti-CSPG6 antibody produced in mouse clone 1G1, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1402450 Monoclonal Anti-CSPG6 antibody produced in mouse clone 2F11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
PLA0019 Rabbit anti-SMC3 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. rabbit, horse, pig, mouse, turkey, bovine, primate, rat, human, chicken, dog, guinea pig
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005445 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005445 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005445 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007790 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007790 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007790 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU064261 MISSION® esiRNA esiRNA human SMC3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005445 Rosetta Predictions human pricing
NM_031583 Rosetta Predictions rat pricing
NM_007790 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005445 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038783 predicted 1819
2 SASI_Hs02_00339605 predicted 758
3 SASI_Hs01_00038786 predicted 1023
4 SASI_Hs01_00038787 predicted 484
5 SASI_Hs01_00038788 predicted 277
6 SASI_Hs01_00038789 predicted 1893
7 SASI_Hs01_00038790 predicted 594
8 SASI_Hs01_00038791 predicted 2436
9 SASI_Hs01_00038792 predicted 1685
10 SASI_Hs02_00339606 predicted 1192
11 SASI_Hs01_00038784 predicted 628
12 SASI_Hs01_00038785 predicted 2320
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031583 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264846 predicted 1929
2 SASI_Rn01_00117904 predicted 1810
3 SASI_Rn01_00117902 predicted 2855
4 SASI_Rn01_00117905 predicted 617
5 SASI_Rn01_00117906 predicted 585
6 SASI_Rn01_00117907 predicted 1887
7 SASI_Rn02_00264847 predicted 3150
8 SASI_Rn01_00117910 predicted 1358
9 SASI_Rn02_00264848 predicted 1645
10 SASI_Rn02_00264849 predicted 1955
11 SASI_Rn01_00117903 predicted 3138
12 SASI_Rn01_00117908 predicted 1911
13 SASI_Rn01_00117909 predicted 1615
14 SASI_Rn01_00117911 predicted 726
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007790 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134471 predicted 2878
2 SASI_Mm01_00134472 predicted 944
3 SASI_Mm01_00134474 predicted 1376
4 SASI_Mm01_00134475 predicted 1381
5 SASI_Mm01_00134476 predicted 1984
6 SASI_Mm01_00134477 predicted 1951
7 SASI_Mm02_00312478 predicted 1674
8 SASI_Mm01_00134478 predicted 1222
9 SASI_Mm01_00134479 predicted 1181
10 SASI_Mm02_00312479 predicted 1434
11 SASI_Mm01_00134473 predicted 1903
12 SASI_Mm01_00134480 predicted 2031
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005445
VALIDATED
SMC3 MISSION shRNA Bacterial Glycerol Stock
structural maintenance of chromosomes 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005445.3-329s21c1
Sequence:CCGGGTACTGGTCCTCGTGTTATTTCTCGAGAAATAACACGAGGACCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234321    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005445.3-3796s21c1
Sequence:CCGGTACTGGTTTGGGAGATGTATACTCGAGTATACATCTCCCAAACCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005445.3-3184s21c1
Sequence:GTACCGGGTACTTGAACTTCGGAAATATCTCGAGATATTTCCGAAGTTCAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005445.3-2315s21c1
Sequence:CCGGCATCTAGAGATAGCATATTATCTCGAGATAATATGCTATCTCTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_005445.3-386s21c1
Sequence:CCGGACCGGTTACCAATCGATAAAGCTCGAGCTTTATCGATTGGTAACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005445.2-425s1c1
Sequence:CCGGGACAAGAAGATGGTCACGAAACTCGAGTTTCGTGACCATCTTCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_005445.2-2570s1c1
Sequence:CCGGCGAGTAGAGACTTATCTCAATCTCGAGATTGAGATAAGTCTCTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005445.2-3001s1c1
Sequence:CCGGGCAGTGCAACACAGAATTAAACTCGAGTTTAATTCTGTGTTGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005445.2-3211s1c1
Sequence:CCGGCAGTGAAGTATTCCAGAAGTTCTCGAGAACTTCTGGAATACTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005445.2-2359s1c1
Sequence:CCGGGCAACGTAGCTTACAGAGTTTCTCGAGAAACTCTGTAAGCTACGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005445.2-2614s1c1
Sequence:CCGGCCAAGTAGAACAGGAACTTAACTCGAGTTAAGTTCCTGTTCTACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005445
VALIDATED
SMC3 MISSION shRNA shRNA Plasmid DNA
structural maintenance of chromosomes 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005445.3-329s21c1
Sequence:CCGGGTACTGGTCCTCGTGTTATTTCTCGAGAAATAACACGAGGACCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234321    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005445.3-3796s21c1
Sequence:CCGGTACTGGTTTGGGAGATGTATACTCGAGTATACATCTCCCAAACCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005445.3-3184s21c1
Sequence:GTACCGGGTACTTGAACTTCGGAAATATCTCGAGATATTTCCGAAGTTCAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005445.3-2315s21c1
Sequence:CCGGCATCTAGAGATAGCATATTATCTCGAGATAATATGCTATCTCTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_005445.3-386s21c1
Sequence:CCGGACCGGTTACCAATCGATAAAGCTCGAGCTTTATCGATTGGTAACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005445.2-425s1c1
Sequence:CCGGGACAAGAAGATGGTCACGAAACTCGAGTTTCGTGACCATCTTCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_005445.2-2570s1c1
Sequence:CCGGCGAGTAGAGACTTATCTCAATCTCGAGATTGAGATAAGTCTCTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005445.2-3001s1c1
Sequence:CCGGGCAGTGCAACACAGAATTAAACTCGAGTTTAATTCTGTGTTGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005445.2-3211s1c1
Sequence:CCGGCAGTGAAGTATTCCAGAAGTTCTCGAGAACTTCTGGAATACTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005445.2-2359s1c1
Sequence:CCGGGCAACGTAGCTTACAGAGTTTCTCGAGAAACTCTGTAAGCTACGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005445.2-2614s1c1
Sequence:CCGGCCAAGTAGAACAGGAACTTAACTCGAGTTAAGTTCCTGTTCTACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005445
VALIDATED
SMC3 MISSION shRNA Lentiviral Transduction Particles
structural maintenance of chromosomes 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005445.3-329s21c1
Sequence:CCGGGTACTGGTCCTCGTGTTATTTCTCGAGAAATAACACGAGGACCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234321    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005445.3-3796s21c1
Sequence:CCGGTACTGGTTTGGGAGATGTATACTCGAGTATACATCTCCCAAACCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005445.3-3184s21c1
Sequence:GTACCGGGTACTTGAACTTCGGAAATATCTCGAGATATTTCCGAAGTTCAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005445.3-2315s21c1
Sequence:CCGGCATCTAGAGATAGCATATTATCTCGAGATAATATGCTATCTCTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_005445.3-386s21c1
Sequence:CCGGACCGGTTACCAATCGATAAAGCTCGAGCTTTATCGATTGGTAACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005445.2-425s1c1
Sequence:CCGGGACAAGAAGATGGTCACGAAACTCGAGTTTCGTGACCATCTTCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_005445.2-2570s1c1
Sequence:CCGGCGAGTAGAGACTTATCTCAATCTCGAGATTGAGATAAGTCTCTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005445.2-3001s1c1
Sequence:CCGGGCAGTGCAACACAGAATTAAACTCGAGTTTAATTCTGTGTTGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005445.2-3211s1c1
Sequence:CCGGCAGTGAAGTATTCCAGAAGTTCTCGAGAACTTCTGGAATACTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005445.2-2359s1c1
Sequence:CCGGGCAACGTAGCTTACAGAGTTTCTCGAGAAACTCTGTAAGCTACGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005445.2-2614s1c1
Sequence:CCGGCCAAGTAGAACAGGAACTTAACTCGAGTTAAGTTCCTGTTCTACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007790
VALIDATED
SMC3 MISSION shRNA Bacterial Glycerol Stock
structural maintenance of chromosomes 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007790.2-3903s1c1
Sequence:CCGGCCCTGTAATGTTACATTTCTACTCGAGTAGAAATGTAACATTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007790.2-1895s1c1
Sequence:CCGGCCTGAAACTAACGATGCTATTCTCGAGAATAGCATCGTTAGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007790.2-908s1c1
Sequence:CCGGCGCCAGGTTAGAGAACTGAAACTCGAGTTTCAGTTCTCTAACCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007790.2-3123s1c1
Sequence:CCGGGCTACAAATCAATCATGGAATCTCGAGATTCCATGATTGATTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007790.2-3598s1c1
Sequence:CCGGCCAGTTTATTACCACTACTTTCTCGAGAAAGTAGTGGTAATAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007790
VALIDATED
SMC3 MISSION shRNA shRNA Plasmid DNA
structural maintenance of chromosomes 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007790.2-3903s1c1
Sequence:CCGGCCCTGTAATGTTACATTTCTACTCGAGTAGAAATGTAACATTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007790.2-1895s1c1
Sequence:CCGGCCTGAAACTAACGATGCTATTCTCGAGAATAGCATCGTTAGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007790.2-908s1c1
Sequence:CCGGCGCCAGGTTAGAGAACTGAAACTCGAGTTTCAGTTCTCTAACCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007790.2-3123s1c1
Sequence:CCGGGCTACAAATCAATCATGGAATCTCGAGATTCCATGATTGATTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007790.2-3598s1c1
Sequence:CCGGCCAGTTTATTACCACTACTTTCTCGAGAAAGTAGTGGTAATAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007790
VALIDATED
SMC3 MISSION shRNA Lentiviral Transduction Particles
structural maintenance of chromosomes 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007790.2-3903s1c1
Sequence:CCGGCCCTGTAATGTTACATTTCTACTCGAGTAGAAATGTAACATTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007790.2-1895s1c1
Sequence:CCGGCCTGAAACTAACGATGCTATTCTCGAGAATAGCATCGTTAGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007790.2-908s1c1
Sequence:CCGGCGCCAGGTTAGAGAACTGAAACTCGAGTTTCAGTTCTCTAACCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007790.2-3123s1c1
Sequence:CCGGGCTACAAATCAATCATGGAATCTCGAGATTCCATGATTGATTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007790.2-3598s1c1
Sequence:CCGGCCAGTTTATTACCACTACTTTCTCGAGAAAGTAGTGGTAATAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks