EMAIL THIS PAGE TO A FRIEND

SMCHD1

structural maintenance of chromosomes flexible hinge domain containing 1

UniProtKB ID: A6NHR9, O75141, Q6AHX6, Q6ZTQ8, Q9H6Q2, Q9UG39
Gene ID:
Human(23347) Summary: This gene encodes a protein which contains a hinge region domain found in members of the SMC (structural maintenance of chromosomes) protein family. [provided by RefSeq, Dec 2011]
Mouse(74355) SMC hinge domain containing 1
Rat(316732) structural maintenance of chromosomes flexible hinge domain containing 1
Zebrafish(497282) structural maintenance of chromosomes flexible hinge domain containing 1
Horse(100062029) structural maintenance of chromosomes flexible hinge domain containing 1
domestic cat(101087430) structural maintenance of chromosomes flexible hinge domain containing 1
chicken(421057) structural maintenance of chromosomes flexible hinge domain containing 1
dog(490535) structural maintenance of chromosomes flexible hinge domain containing 1
naked mole-rat(101725927) structural maintenance of chromosomes flexible hinge domain containing 1
domestic guinea pig(100717339) structural maintenance of chromosomes flexible hinge domain containing 1
cow(537894) structural maintenance of chromosomes flexible hinge domain containing 1
sheep(101122749) structural maintenance of chromosomes flexible hinge domain containing 1
177 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028887 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028887 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028887 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015295 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015295 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015295 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015295 Rosetta Predictions human pricing
XM_113962 Rosetta Predictions human pricing
XM_001056555 Rosetta Predictions rat pricing
XM_244261 Rosetta Predictions rat pricing
NM_028887 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015295 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347486 predicted 6064
2 SASI_Hs02_00347487 predicted 5396
3 SASI_Hs02_00347488 predicted 3947
4 SASI_Hs02_00347489 predicted 509
5 SASI_Hs02_00347490 predicted 2406
6 SASI_Hs02_00347491 predicted 3683
7 SASI_Hs02_00347492 predicted 2741
8 SASI_Hs02_00347493 predicted 4601
9 SASI_Hs02_00347494 predicted 5178
10 SASI_Hs02_00347495 predicted 5382
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_113962 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00279498 predicted 5599
2 SASI_Hs01_00279499 predicted 5712
3 SASI_Hs01_00279500 predicted 5417
4 SASI_Hs01_00279501 predicted 5427
5 SASI_Hs01_00279502 predicted 5748
6 SASI_Hs01_00279503 predicted 5927
7 SASI_Hs01_00279504 predicted 5254
8 SASI_Hs01_00279505 predicted 5296
9 SASI_Hs01_00279506 predicted 5496
10 SASI_Hs01_00279507 predicted 5754
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056555 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00283626 predicted 5900
2 SASI_Rn02_00283627 predicted 1706
3 SASI_Rn02_00283628 predicted 4278
4 SASI_Rn02_00283629 predicted 4091
5 SASI_Rn02_00283630 predicted 1847
6 SASI_Rn02_00283631 predicted 271
7 SASI_Rn02_00283632 predicted 5039
8 SASI_Rn02_00283633 predicted 2735
9 SASI_Rn02_00283634 predicted 3068
10 SASI_Rn02_00283635 predicted 4735
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_244261 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391829 predicted 5896
2 SASI_Rn02_00391830 predicted 1704
3 SASI_Rn02_00391831 predicted 4278
4 SASI_Rn02_00391832 predicted 4088
5 SASI_Rn02_00391833 predicted 1837
6 SASI_Rn02_00391834 predicted 277
7 SASI_Rn02_00391835 predicted 5032
8 SASI_Rn02_00391836 predicted 2740
9 SASI_Rn02_00391837 predicted 3064
10 SASI_Rn02_00391838 predicted 4739
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028887 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334569 predicted 1849
2 SASI_Mm02_00334570 predicted 1330
3 SASI_Mm01_00199158 predicted 2843
4 SASI_Mm02_00334571 predicted 563
5 SASI_Mm01_00199159 predicted 2803
6 SASI_Mm02_00334572 predicted 837
7 SASI_Mm01_00199160 predicted 5040
8 SASI_Mm01_00199162 predicted 4739
9 SASI_Mm01_00199163 predicted 3751
10 SASI_Mm02_00334573 predicted 1051
11 SASI_Mm01_00199157 predicted 1066
12 SASI_Mm01_00199161 predicted 2452
13 SASI_Mm01_00199164 predicted 1784
14 SASI_Mm01_00199165 predicted 852
15 SASI_Mm01_00199166 predicted 2393
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028887
VALIDATED
SMCHD1 MISSION shRNA Bacterial Glycerol Stock
structural maintenance of chromosomes flexible hinge domain containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028887.3-639s21c1
Sequence:CCGGGTCAGCTACTTCTCGAAATAACTCGAGTTATTTCGAGAAGTAGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028887.3-559s21c1
Sequence:CCGGAGTGGCATGTATGAGTATTATCTCGAGATAATACTCATACATGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028887.3-1208s21c1
Sequence:CCGGCACGACAGCTAACGCATATTTCTCGAGAAATATGCGTTAGCTGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028887.3-1208s1c1
Sequence:CCGGCACGACAGCTAACGCATATTTCTCGAGAAATATGCGTTAGCTGTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028887.3-639s1c1
Sequence:CCGGGTCAGCTACTTCTCGAAATAACTCGAGTTATTTCGAGAAGTAGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028887.3-5672s21c1
Sequence:CCGGTGTTAGGAGACACCATTATTTCTCGAGAAATAATGGTGTCTCCTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250981    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028887.3-6221s21c1
Sequence:CCGGTGATAATCCTGGCAAGAATTTCTCGAGAAATTCTTGCCAGGATTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182933    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028887.2-4113s1c1
Sequence:CCGGCCATTGAAGCTATTCAACTTTCTCGAGAAAGTTGAATAGCTTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028887.2-1212s1c1
Sequence:CCGGGCAGGTGATGTAATACGCAATCTCGAGATTGCGTATTACATCACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028887
VALIDATED
SMCHD1 MISSION shRNA shRNA Plasmid DNA
structural maintenance of chromosomes flexible hinge domain containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028887.3-639s21c1
Sequence:CCGGGTCAGCTACTTCTCGAAATAACTCGAGTTATTTCGAGAAGTAGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028887.3-559s21c1
Sequence:CCGGAGTGGCATGTATGAGTATTATCTCGAGATAATACTCATACATGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028887.3-1208s21c1
Sequence:CCGGCACGACAGCTAACGCATATTTCTCGAGAAATATGCGTTAGCTGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028887.3-1208s1c1
Sequence:CCGGCACGACAGCTAACGCATATTTCTCGAGAAATATGCGTTAGCTGTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028887.3-639s1c1
Sequence:CCGGGTCAGCTACTTCTCGAAATAACTCGAGTTATTTCGAGAAGTAGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028887.3-5672s21c1
Sequence:CCGGTGTTAGGAGACACCATTATTTCTCGAGAAATAATGGTGTCTCCTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250981    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028887.3-6221s21c1
Sequence:CCGGTGATAATCCTGGCAAGAATTTCTCGAGAAATTCTTGCCAGGATTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182933    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028887.2-4113s1c1
Sequence:CCGGCCATTGAAGCTATTCAACTTTCTCGAGAAAGTTGAATAGCTTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028887.2-1212s1c1
Sequence:CCGGGCAGGTGATGTAATACGCAATCTCGAGATTGCGTATTACATCACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028887
VALIDATED
SMCHD1 MISSION shRNA Lentiviral Transduction Particles
structural maintenance of chromosomes flexible hinge domain containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028887.3-639s21c1
Sequence:CCGGGTCAGCTACTTCTCGAAATAACTCGAGTTATTTCGAGAAGTAGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028887.3-559s21c1
Sequence:CCGGAGTGGCATGTATGAGTATTATCTCGAGATAATACTCATACATGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028887.3-1208s21c1
Sequence:CCGGCACGACAGCTAACGCATATTTCTCGAGAAATATGCGTTAGCTGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028887.3-1208s1c1
Sequence:CCGGCACGACAGCTAACGCATATTTCTCGAGAAATATGCGTTAGCTGTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028887.3-639s1c1
Sequence:CCGGGTCAGCTACTTCTCGAAATAACTCGAGTTATTTCGAGAAGTAGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028887.3-5672s21c1
Sequence:CCGGTGTTAGGAGACACCATTATTTCTCGAGAAATAATGGTGTCTCCTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250981    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028887.3-6221s21c1
Sequence:CCGGTGATAATCCTGGCAAGAATTTCTCGAGAAATTCTTGCCAGGATTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182933    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028887.2-4113s1c1
Sequence:CCGGCCATTGAAGCTATTCAACTTTCTCGAGAAAGTTGAATAGCTTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028887.2-1212s1c1
Sequence:CCGGGCAGGTGATGTAATACGCAATCTCGAGATTGCGTATTACATCACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015295
VALIDATED
SMCHD1 MISSION shRNA Bacterial Glycerol Stock
structural maintenance of chromosomes flexible hinge domain containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015295.2-8104s21c1
Sequence:CCGGTGGCGAGTTCTATGGATATTACTCGAGTAATATCCATAGAACTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_015295.2-3920s21c1
Sequence:CCGGTTATTCGAGTGCAACTAATTTCTCGAGAAATTAGTTGCACTCGAATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_015295.2-3365s21c1
Sequence:CCGGATTGGATAGCGGGTGATATTACTCGAGTAATATCACCCGCTATCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_015295.2-1217s21c1
Sequence:CCGGCACGACAGTTAGCGCATATTTCTCGAGAAATATGCGCTAACTGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_015295.2-5678s21c1
Sequence:CCGGTGTTAGGAGACACCATTATTTCTCGAGAAATAATGGTGTCTCCTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015295
VALIDATED
SMCHD1 MISSION shRNA shRNA Plasmid DNA
structural maintenance of chromosomes flexible hinge domain containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015295.2-8104s21c1
Sequence:CCGGTGGCGAGTTCTATGGATATTACTCGAGTAATATCCATAGAACTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_015295.2-3920s21c1
Sequence:CCGGTTATTCGAGTGCAACTAATTTCTCGAGAAATTAGTTGCACTCGAATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_015295.2-3365s21c1
Sequence:CCGGATTGGATAGCGGGTGATATTACTCGAGTAATATCACCCGCTATCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_015295.2-1217s21c1
Sequence:CCGGCACGACAGTTAGCGCATATTTCTCGAGAAATATGCGCTAACTGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_015295.2-5678s21c1
Sequence:CCGGTGTTAGGAGACACCATTATTTCTCGAGAAATAATGGTGTCTCCTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015295
VALIDATED
SMCHD1 MISSION shRNA Lentiviral Transduction Particles
structural maintenance of chromosomes flexible hinge domain containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015295.2-8104s21c1
Sequence:CCGGTGGCGAGTTCTATGGATATTACTCGAGTAATATCCATAGAACTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_015295.2-3920s21c1
Sequence:CCGGTTATTCGAGTGCAACTAATTTCTCGAGAAATTAGTTGCACTCGAATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_015295.2-3365s21c1
Sequence:CCGGATTGGATAGCGGGTGATATTACTCGAGTAATATCACCCGCTATCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_015295.2-1217s21c1
Sequence:CCGGCACGACAGTTAGCGCATATTTCTCGAGAAATATGCGCTAACTGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_015295.2-5678s21c1
Sequence:CCGGTGTTAGGAGACACCATTATTTCTCGAGAAATAATGGTGTCTCCTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks