EMAIL THIS PAGE TO A FRIEND

SMCP

sperm mitochondria-associated cysteine-rich protein

Synonyms: HSMCSGEN1 MCS MCSP
UniProtKB ID: P49901, Q96A42
Gene ID:
Human(4184) Summary: Sperm mitochondria differ in morphology and subcellular localization from those of somatic cells. They are elongated, flattened, and arranged circumferentially to form a helical coiled sheath in the midpiece of the sperm flagellum. The protein encoded by this gene localizes to the capsule associated with the mitochondrial outer membranes and is thought to function in the organization and stabilization of the helical structure of the sperm's mitochondrial sheath. [provided by RefSeq, Jul 2008]
Mouse(17235) sperm mitochondria-associated cysteine-rich protein
Rat(24899) sperm mitochondria-associated cysteine-rich protein
dog(595144) sperm mitochondria-associated cysteine-rich protein
cow(493777) sperm mitochondria-associated cysteine-rich protein
sheep(101123167) sperm mitochondria-associated cysteine-rich protein
domestic guinea pig(101787854) sperm mitochondria-associated cysteine-rich protein
naked mole-rat(101696635) sperm mitochondria-associated cysteine-rich protein
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030663 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030663 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030663 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008574 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008574 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008574 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU053021 MISSION® esiRNA esiRNA human SMCP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030663 Rosetta Predictions human pricing
NM_031536 Rosetta Predictions rat pricing
NM_008574 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030663 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128678 predicted 483
2 SASI_Hs01_00128679 predicted 233
3 SASI_Hs01_00128681 predicted 401
4 SASI_Hs01_00128682 predicted 401
5 SASI_Hs01_00128683 predicted 307
6 SASI_Hs01_00128686 predicted 259
7 SASI_Hs01_00128687 predicted 495
8 SASI_Hs02_00358246 predicted 228
9 SASI_Hs02_00358247 predicted 365
10 SASI_Hs02_00358248 predicted 424
11 SASI_Hs01_00128680 predicted 494
12 SASI_Hs01_00128684 predicted 492
13 SASI_Hs01_00128685 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031536 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264694 predicted 502
2 SASI_Rn01_00106110 predicted 379
3 SASI_Rn01_00106111 predicted 573
4 SASI_Rn01_00106112 predicted 559
5 SASI_Rn01_00106113 predicted 586
6 SASI_Rn01_00106114 predicted 502
7 SASI_Rn02_00264695 predicted 414
8 SASI_Rn01_00106116 predicted 387
9 SASI_Rn02_00264696 predicted 374
10 SASI_Rn01_00106119 predicted 401
11 SASI_Rn01_00106115 predicted 217
12 SASI_Rn01_00106117 predicted 636
13 SASI_Rn01_00106118 predicted 612
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008574 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198329 predicted 644
2 SASI_Mm01_00198332 predicted 651
3 SASI_Mm01_00198333 predicted 637
4 SASI_Mm01_00198334 predicted 651
5 SASI_Mm01_00198336 predicted 611
6 SASI_Mm01_00198337 predicted 633
7 SASI_Mm01_00198328 predicted 620
8 SASI_Mm02_00314191 predicted 769
9 SASI_Mm02_00314192 predicted 829
10 SASI_Mm02_00314193 predicted 170
11 SASI_Mm01_00198330 predicted 588
12 SASI_Mm01_00198331 predicted 583
13 SASI_Mm01_00198335 predicted 587
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030663
SMCP MISSION shRNA Bacterial Glycerol Stock
sperm mitochondria-associated cysteine-rich protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030663.2-238s21c1
Sequence:CCGGCAATCAATGCTGCCCACCAAACTCGAGTTTGGTGGGCAGCATTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030663.2-286s21c1
Sequence:CCGGCAGTCAATGCTGCCCACCAAACTCGAGTTTGGTGGGCAGCATTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030663.2-214s21c1
Sequence:CCGGGAACCAGTGCTGCCAGTCAAACTCGAGTTTGACTGGCAGCACTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030663.2-369s21c1
Sequence:CCGGAGACCAAGCCTGAAGTCTCACCTCGAGGTGAGACTTCAGGCTTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157426    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030663.2-572s1c1
Sequence:CCGGGTCAGGCTAGACCTGTGTTTACTCGAGTAAACACAGGTCTAGCCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030663.2-610s1c1
Sequence:CCGGGTGACTACCATTTCCACCCAACTCGAGTTGGGTGGAAATGGTAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154181    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030663.2-583s1c1
Sequence:CCGGCCTGTGTTTAGAGAAGCAGTTCTCGAGAACTGCTTCTCTAAACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030663.2-577s1c1
Sequence:CCGGGCTAGACCTGTGTTTAGAGAACTCGAGTTCTCTAAACACAGGTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030663.2-497s1c1
Sequence:CCGGGAGCAGAAGAAGTCAAACAAACTCGAGTTTGTTTGACTTCTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030663
SMCP MISSION shRNA shRNA Plasmid DNA
sperm mitochondria-associated cysteine-rich protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030663.2-238s21c1
Sequence:CCGGCAATCAATGCTGCCCACCAAACTCGAGTTTGGTGGGCAGCATTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030663.2-286s21c1
Sequence:CCGGCAGTCAATGCTGCCCACCAAACTCGAGTTTGGTGGGCAGCATTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030663.2-214s21c1
Sequence:CCGGGAACCAGTGCTGCCAGTCAAACTCGAGTTTGACTGGCAGCACTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030663.2-369s21c1
Sequence:CCGGAGACCAAGCCTGAAGTCTCACCTCGAGGTGAGACTTCAGGCTTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157426    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030663.2-572s1c1
Sequence:CCGGGTCAGGCTAGACCTGTGTTTACTCGAGTAAACACAGGTCTAGCCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030663.2-610s1c1
Sequence:CCGGGTGACTACCATTTCCACCCAACTCGAGTTGGGTGGAAATGGTAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154181    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030663.2-583s1c1
Sequence:CCGGCCTGTGTTTAGAGAAGCAGTTCTCGAGAACTGCTTCTCTAAACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030663.2-577s1c1
Sequence:CCGGGCTAGACCTGTGTTTAGAGAACTCGAGTTCTCTAAACACAGGTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030663.2-497s1c1
Sequence:CCGGGAGCAGAAGAAGTCAAACAAACTCGAGTTTGTTTGACTTCTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030663
SMCP MISSION shRNA Lentiviral Transduction Particles
sperm mitochondria-associated cysteine-rich protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030663.2-238s21c1
Sequence:CCGGCAATCAATGCTGCCCACCAAACTCGAGTTTGGTGGGCAGCATTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030663.2-286s21c1
Sequence:CCGGCAGTCAATGCTGCCCACCAAACTCGAGTTTGGTGGGCAGCATTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030663.2-214s21c1
Sequence:CCGGGAACCAGTGCTGCCAGTCAAACTCGAGTTTGACTGGCAGCACTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030663.2-369s21c1
Sequence:CCGGAGACCAAGCCTGAAGTCTCACCTCGAGGTGAGACTTCAGGCTTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157426    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030663.2-572s1c1
Sequence:CCGGGTCAGGCTAGACCTGTGTTTACTCGAGTAAACACAGGTCTAGCCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030663.2-610s1c1
Sequence:CCGGGTGACTACCATTTCCACCCAACTCGAGTTGGGTGGAAATGGTAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154181    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030663.2-583s1c1
Sequence:CCGGCCTGTGTTTAGAGAAGCAGTTCTCGAGAACTGCTTCTCTAAACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030663.2-577s1c1
Sequence:CCGGGCTAGACCTGTGTTTAGAGAACTCGAGTTCTCTAAACACAGGTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030663.2-497s1c1
Sequence:CCGGGAGCAGAAGAAGTCAAACAAACTCGAGTTTGTTTGACTTCTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008574
SMCP MISSION shRNA Bacterial Glycerol Stock
sperm mitochondria-associated cysteine-rich protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008574.2-122s1c1
Sequence:CCGGGCTGAACTAAGAAGAGCCCAACTCGAGTTGGGCTCTTCTTAGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008574.2-71s1c1
Sequence:CCGGGCTGAAACATCCAGGAAACTACTCGAGTAGTTTCCTGGATGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008574.2-744s1c1
Sequence:CCGGCGACCTAACTGTAGGCTACTACTCGAGTAGTAGCCTACAGTTAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008574.2-597s1c1
Sequence:CCGGCCAGAAGAAGTCAAACAAATACTCGAGTATTTGTTTGACTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008574.2-183s1c1
Sequence:CCGGGAAGATGAGTGATCCATCCAACTCGAGTTGGATGGATCACTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008574
SMCP MISSION shRNA shRNA Plasmid DNA
sperm mitochondria-associated cysteine-rich protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008574.2-122s1c1
Sequence:CCGGGCTGAACTAAGAAGAGCCCAACTCGAGTTGGGCTCTTCTTAGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008574.2-71s1c1
Sequence:CCGGGCTGAAACATCCAGGAAACTACTCGAGTAGTTTCCTGGATGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008574.2-744s1c1
Sequence:CCGGCGACCTAACTGTAGGCTACTACTCGAGTAGTAGCCTACAGTTAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008574.2-597s1c1
Sequence:CCGGCCAGAAGAAGTCAAACAAATACTCGAGTATTTGTTTGACTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008574.2-183s1c1
Sequence:CCGGGAAGATGAGTGATCCATCCAACTCGAGTTGGATGGATCACTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008574
SMCP MISSION shRNA Lentiviral Transduction Particles
sperm mitochondria-associated cysteine-rich protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008574.2-122s1c1
Sequence:CCGGGCTGAACTAAGAAGAGCCCAACTCGAGTTGGGCTCTTCTTAGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008574.2-71s1c1
Sequence:CCGGGCTGAAACATCCAGGAAACTACTCGAGTAGTTTCCTGGATGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008574.2-744s1c1
Sequence:CCGGCGACCTAACTGTAGGCTACTACTCGAGTAGTAGCCTACAGTTAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008574.2-597s1c1
Sequence:CCGGCCAGAAGAAGTCAAACAAATACTCGAGTATTTGTTTGACTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008574.2-183s1c1
Sequence:CCGGGAAGATGAGTGATCCATCCAACTCGAGTTGGATGGATCACTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks