EMAIL THIS PAGE TO A FRIEND

SMDT1

single-pass membrane protein with aspartate-rich tail 1

Synonyms: C22orf32 DDDD dJ186O1.1
UniProtKB ID: Q9H4I9, B2R5D1, Q8TAB9
Gene ID:
Mouse(69029) single-pass membrane protein with aspartate rich tail 1
Rat(315166) single-pass membrane protein with aspartate-rich tail 1
cow(506149) single-pass membrane protein with aspartate-rich tail 1
domestic guinea pig(100713934) single-pass membrane protein with aspartate-rich tail 1
naked mole-rat(101725774) single-pass membrane protein with aspartate-rich tail 1
dog(609643) single-pass membrane protein with aspartate-rich tail 1
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033318 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033318 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033318 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026914 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026914 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026914 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033318 Rosetta Predictions human pricing
XM_235517 Rosetta Predictions rat pricing
NM_026914 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033318 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058731 predicted 387
2 SASI_Hs01_00058732 predicted 706
3 SASI_Hs02_00361171 predicted 325
4 SASI_Hs01_00058733 predicted 594
5 SASI_Hs01_00058734 predicted 328
6 SASI_Hs01_00058735 predicted 678
7 SASI_Hs01_00058736 predicted 559
8 SASI_Hs01_00058737 predicted 514
9 SASI_Hs01_00058739 predicted 416
10 SASI_Hs01_00058740 predicted 566
11 SASI_Hs01_00058738 predicted 588
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235517 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389410 predicted 372
2 SASI_Rn02_00389411 predicted 594
3 SASI_Rn02_00389412 predicted 547
4 SASI_Rn02_00389413 predicted 563
5 SASI_Rn02_00389414 predicted 613
6 SASI_Rn02_00389415 predicted 544
7 SASI_Rn02_00389416 predicted 404
8 SASI_Rn02_00389417 predicted 603
9 SASI_Rn02_00389418 predicted 373
10 SASI_Rn02_00389419 predicted 384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026914 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164031 predicted 222
2 SASI_Mm01_00164032 predicted 268
3 SASI_Mm01_00164033 predicted 287
4 SASI_Mm01_00164034 predicted 275
5 SASI_Mm01_00164035 predicted 221
6 SASI_Mm01_00164036 predicted 238
7 SASI_Mm01_00164037 predicted 274
8 SASI_Mm01_00164038 predicted 303
9 SASI_Mm01_00164039 predicted 342
10 SASI_Mm01_00164040 predicted 238
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033318
VALIDATED
SMDT1 MISSION shRNA Bacterial Glycerol Stock
single-pass membrane protein with aspartate-rich tail 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000453359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033318.3-100s21c1
Sequence:CCGGTAGTATTGGCACCCGTCAGGTCTCGAGACCTGACGGGTGCCAATACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033318.3-523s21c1
Sequence:CCGGGTATGGTCCATGACCGTATTCCTCGAGGAATACGGTCATGGACCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445035    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033318.3-756s21c1
Sequence:CCGGGTGGAGCCTGGTGAACTATTCCTCGAGGAATAGTTCACCAGGCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033318.3-903s1c1
Sequence:CCGGGCTCTGCTTGTTAGCATACTACTCGAGTAGTATGCTAACAAGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033318.3-314s1c1
Sequence:CCGGCGGGACACTCATTAGCAAGAACTCGAGTTCTTGCTAATGAGTGTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033318.3-278s1c1
Sequence:CCGGGCGTGTGTTCTCCATTGTGATCTCGAGATCACAATGGAGAACACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033318.3-329s1c1
Sequence:CCGGCAAGAACTTTGCTGCTCTACTCTCGAGAGTAGAGCAGCAAAGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033318.3-328s1c1
Sequence:CCGGGCAAGAACTTTGCTGCTCTACCTCGAGGTAGAGCAGCAAAGTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121945    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_033318.3-814s1c1
Sequence:CCGGCCCAACAGAAACTGTGCATTTCTCGAGAAATGCACAGTTTCTGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033318.3-372s1c1
Sequence:CCGGCCAGAGGATGATGATGATGATCTCGAGATCATCATCATCATCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033318.3-345s1c1
Sequence:CCGGCTACTTGAGGAACATGACATTCTCGAGAATGTCATGTTCCTCAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033318.3-317s1c1
Sequence:CCGGGACACTCATTAGCAAGAACTTCTCGAGAAGTTCTTGCTAATGAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033318
VALIDATED
SMDT1 MISSION shRNA shRNA Plasmid DNA
single-pass membrane protein with aspartate-rich tail 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000453359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033318.3-100s21c1
Sequence:CCGGTAGTATTGGCACCCGTCAGGTCTCGAGACCTGACGGGTGCCAATACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033318.3-523s21c1
Sequence:CCGGGTATGGTCCATGACCGTATTCCTCGAGGAATACGGTCATGGACCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445035    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033318.3-756s21c1
Sequence:CCGGGTGGAGCCTGGTGAACTATTCCTCGAGGAATAGTTCACCAGGCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033318.3-903s1c1
Sequence:CCGGGCTCTGCTTGTTAGCATACTACTCGAGTAGTATGCTAACAAGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033318.3-314s1c1
Sequence:CCGGCGGGACACTCATTAGCAAGAACTCGAGTTCTTGCTAATGAGTGTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033318.3-278s1c1
Sequence:CCGGGCGTGTGTTCTCCATTGTGATCTCGAGATCACAATGGAGAACACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033318.3-329s1c1
Sequence:CCGGCAAGAACTTTGCTGCTCTACTCTCGAGAGTAGAGCAGCAAAGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033318.3-328s1c1
Sequence:CCGGGCAAGAACTTTGCTGCTCTACCTCGAGGTAGAGCAGCAAAGTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121945    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_033318.3-814s1c1
Sequence:CCGGCCCAACAGAAACTGTGCATTTCTCGAGAAATGCACAGTTTCTGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033318.3-372s1c1
Sequence:CCGGCCAGAGGATGATGATGATGATCTCGAGATCATCATCATCATCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033318.3-345s1c1
Sequence:CCGGCTACTTGAGGAACATGACATTCTCGAGAATGTCATGTTCCTCAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033318.3-317s1c1
Sequence:CCGGGACACTCATTAGCAAGAACTTCTCGAGAAGTTCTTGCTAATGAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033318
VALIDATED
SMDT1 MISSION shRNA Lentiviral Transduction Particles
single-pass membrane protein with aspartate-rich tail 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000453359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033318.3-100s21c1
Sequence:CCGGTAGTATTGGCACCCGTCAGGTCTCGAGACCTGACGGGTGCCAATACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033318.3-523s21c1
Sequence:CCGGGTATGGTCCATGACCGTATTCCTCGAGGAATACGGTCATGGACCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445035    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033318.3-756s21c1
Sequence:CCGGGTGGAGCCTGGTGAACTATTCCTCGAGGAATAGTTCACCAGGCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033318.3-903s1c1
Sequence:CCGGGCTCTGCTTGTTAGCATACTACTCGAGTAGTATGCTAACAAGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033318.3-314s1c1
Sequence:CCGGCGGGACACTCATTAGCAAGAACTCGAGTTCTTGCTAATGAGTGTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033318.3-278s1c1
Sequence:CCGGGCGTGTGTTCTCCATTGTGATCTCGAGATCACAATGGAGAACACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033318.3-329s1c1
Sequence:CCGGCAAGAACTTTGCTGCTCTACTCTCGAGAGTAGAGCAGCAAAGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033318.3-328s1c1
Sequence:CCGGGCAAGAACTTTGCTGCTCTACCTCGAGGTAGAGCAGCAAAGTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121945    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_033318.3-814s1c1
Sequence:CCGGCCCAACAGAAACTGTGCATTTCTCGAGAAATGCACAGTTTCTGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033318.3-372s1c1
Sequence:CCGGCCAGAGGATGATGATGATGATCTCGAGATCATCATCATCATCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033318.3-345s1c1
Sequence:CCGGCTACTTGAGGAACATGACATTCTCGAGAATGTCATGTTCCTCAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033318.3-317s1c1
Sequence:CCGGGACACTCATTAGCAAGAACTTCTCGAGAAGTTCTTGCTAATGAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026914
VALIDATED
SMDT1 MISSION shRNA Bacterial Glycerol Stock
single-pass membrane protein with aspartate-rich tail 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026914.1-264s21c1
Sequence:CCGGCCCTTTCTCTATGTCGGGACACTCGAGTGTCCCGACATAGAGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026914.1-278s21c1
Sequence:CCGGCGGGACACTCATCAGCAAGAACTCGAGTTCTTGCTGATGAGTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026914.1-237s21c1
Sequence:CCGGCTTCTCCGAGTGTTCTCCATTCTCGAGAATGGAGAACACTCGGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353737    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026914.1-388s21c1
Sequence:CCGGGCACTGATGATGTGGTGGCATCTCGAGATGCCACCACATCATCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026914.1-278s1c1
Sequence:CCGGCGGGACACTCATCAGCAAGAACTCGAGTTCTTGCTGATGAGTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026914.1-242s1c1
Sequence:CCGGCCGAGTGTTCTCCATTGTGATCTCGAGATCACAATGGAGAACACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126049    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026914.1-388s1c1
Sequence:CCGGGCACTGATGATGTGGTGGCATCTCGAGATGCCACCACATCATCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026914.1-264s1c1
Sequence:CCGGCCCTTTCTCTATGTCGGGACACTCGAGTGTCCCGACATAGAGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026914.1-237s1c1
Sequence:CCGGCTTCTCCGAGTGTTCTCCATTCTCGAGAATGGAGAACACTCGGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026914
VALIDATED
SMDT1 MISSION shRNA shRNA Plasmid DNA
single-pass membrane protein with aspartate-rich tail 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026914.1-264s21c1
Sequence:CCGGCCCTTTCTCTATGTCGGGACACTCGAGTGTCCCGACATAGAGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026914.1-278s21c1
Sequence:CCGGCGGGACACTCATCAGCAAGAACTCGAGTTCTTGCTGATGAGTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026914.1-237s21c1
Sequence:CCGGCTTCTCCGAGTGTTCTCCATTCTCGAGAATGGAGAACACTCGGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353737    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026914.1-388s21c1
Sequence:CCGGGCACTGATGATGTGGTGGCATCTCGAGATGCCACCACATCATCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026914.1-278s1c1
Sequence:CCGGCGGGACACTCATCAGCAAGAACTCGAGTTCTTGCTGATGAGTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026914.1-242s1c1
Sequence:CCGGCCGAGTGTTCTCCATTGTGATCTCGAGATCACAATGGAGAACACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126049    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026914.1-388s1c1
Sequence:CCGGGCACTGATGATGTGGTGGCATCTCGAGATGCCACCACATCATCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026914.1-264s1c1
Sequence:CCGGCCCTTTCTCTATGTCGGGACACTCGAGTGTCCCGACATAGAGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026914.1-237s1c1
Sequence:CCGGCTTCTCCGAGTGTTCTCCATTCTCGAGAATGGAGAACACTCGGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026914
VALIDATED
SMDT1 MISSION shRNA Lentiviral Transduction Particles
single-pass membrane protein with aspartate-rich tail 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026914.1-264s21c1
Sequence:CCGGCCCTTTCTCTATGTCGGGACACTCGAGTGTCCCGACATAGAGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026914.1-278s21c1
Sequence:CCGGCGGGACACTCATCAGCAAGAACTCGAGTTCTTGCTGATGAGTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026914.1-237s21c1
Sequence:CCGGCTTCTCCGAGTGTTCTCCATTCTCGAGAATGGAGAACACTCGGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353737    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026914.1-388s21c1
Sequence:CCGGGCACTGATGATGTGGTGGCATCTCGAGATGCCACCACATCATCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026914.1-278s1c1
Sequence:CCGGCGGGACACTCATCAGCAAGAACTCGAGTTCTTGCTGATGAGTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026914.1-242s1c1
Sequence:CCGGCCGAGTGTTCTCCATTGTGATCTCGAGATCACAATGGAGAACACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126049    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026914.1-388s1c1
Sequence:CCGGGCACTGATGATGTGGTGGCATCTCGAGATGCCACCACATCATCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026914.1-264s1c1
Sequence:CCGGCCCTTTCTCTATGTCGGGACACTCGAGTGTCCCGACATAGAGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026914.1-237s1c1
Sequence:CCGGCTTCTCCGAGTGTTCTCCATTCTCGAGAATGGAGAACACTCGGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks