EMAIL THIS PAGE TO A FRIEND

SMIM10

small integral membrane protein 10

Synonyms: CXorf69
UniProtKB ID: Q96HG1
Gene ID:
cow(100302527) small integral membrane protein 10
32 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001163438 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001163438 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001163438 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001715907 Rosetta Predictions human pricing
XM_927661 Rosetta Predictions human pricing
XM_939025 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715907 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00406924 predicted 369
2 SASI_Hs02_00406925 predicted 351
3 SASI_Hs02_00406926 predicted 290
4 SASI_Hs02_00406927 predicted 281
5 SASI_Hs02_00406928 predicted 320
6 SASI_Hs02_00406929 predicted 378
7 SASI_Hs02_00406930 predicted 244
8 SASI_Hs02_00406931 predicted 348
9 SASI_Hs02_00406932 predicted 254
10 SASI_Hs02_00406933 predicted 289
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927661 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00297957 predicted 245
2 SASI_Hs01_00297958 predicted 227
3 SASI_Hs01_00297959 predicted 202
4 SASI_Hs01_00297960 predicted 250
5 SASI_Hs01_00297961 predicted 220
6 SASI_Hs01_00297962 predicted 265
7 SASI_Hs01_00297963 predicted 208
8 SASI_Hs01_00297964 predicted 951
9 SASI_Hs01_00297965 predicted 943
10 SASI_Hs01_00297966 predicted 960
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_939025 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00483422 predicted 249
2 SASI_Hs02_00483423 predicted 227
3 SASI_Hs02_00483424 predicted 203
4 SASI_Hs02_00483425 predicted 248
5 SASI_Hs02_00483426 predicted 217
6 SASI_Hs02_00483427 predicted 259
7 SASI_Hs02_00483428 predicted 213
8 SASI_Hs02_00483429 predicted 951
9 SASI_Hs02_00483430 predicted 945
10 SASI_Hs02_00483431 predicted 963
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001163438
SMIM10 MISSION shRNA Bacterial Glycerol Stock
small integral membrane protein 10
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163438.1-875s21c1
Sequence:CCGGACGAAGTGAATAGACCCAATTCTCGAGAATTGGGTCTATTCACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163438.1-763s21c1
Sequence:CCGGATGGGCACAGAATGCAATAAACTCGAGTTTATTGCATTCTGTGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163438.1-663s21c1
Sequence:CCGGAGGAACAGAATACAGCTTAAACTCGAGTTTAAGCTGTATTCTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163438.1-385s21c1
Sequence:CCGGACGTCCACCTGCAGGTATATACTCGAGTATATACCTGCAGGTGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163438.1-361s21c1
Sequence:CCGGATATTCTGGCCTCGGTGATTCCTCGAGGAATCACCGAGGCCAGAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163438.1-404s21c1
Sequence:CCGGTATTTAGAGCCACTAACTTTGCTCGAGCAAAGTTAGTGGCTCTAAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163438.1-606s21c1
Sequence:CCGGATATAACCCAAATCGTCTAAGCTCGAGCTTAGACGATTTGGGTTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001163438
SMIM10 MISSION shRNA shRNA Plasmid DNA
small integral membrane protein 10
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163438.1-875s21c1
Sequence:CCGGACGAAGTGAATAGACCCAATTCTCGAGAATTGGGTCTATTCACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163438.1-763s21c1
Sequence:CCGGATGGGCACAGAATGCAATAAACTCGAGTTTATTGCATTCTGTGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163438.1-663s21c1
Sequence:CCGGAGGAACAGAATACAGCTTAAACTCGAGTTTAAGCTGTATTCTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163438.1-385s21c1
Sequence:CCGGACGTCCACCTGCAGGTATATACTCGAGTATATACCTGCAGGTGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163438.1-361s21c1
Sequence:CCGGATATTCTGGCCTCGGTGATTCCTCGAGGAATCACCGAGGCCAGAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163438.1-404s21c1
Sequence:CCGGTATTTAGAGCCACTAACTTTGCTCGAGCAAAGTTAGTGGCTCTAAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163438.1-606s21c1
Sequence:CCGGATATAACCCAAATCGTCTAAGCTCGAGCTTAGACGATTTGGGTTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001163438
SMIM10 MISSION shRNA Lentiviral Transduction Particles
small integral membrane protein 10
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163438.1-875s21c1
Sequence:CCGGACGAAGTGAATAGACCCAATTCTCGAGAATTGGGTCTATTCACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163438.1-763s21c1
Sequence:CCGGATGGGCACAGAATGCAATAAACTCGAGTTTATTGCATTCTGTGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163438.1-663s21c1
Sequence:CCGGAGGAACAGAATACAGCTTAAACTCGAGTTTAAGCTGTATTCTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163438.1-385s21c1
Sequence:CCGGACGTCCACCTGCAGGTATATACTCGAGTATATACCTGCAGGTGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163438.1-361s21c1
Sequence:CCGGATATTCTGGCCTCGGTGATTCCTCGAGGAATCACCGAGGCCAGAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163438.1-404s21c1
Sequence:CCGGTATTTAGAGCCACTAACTTTGCTCGAGCAAAGTTAGTGGCTCTAAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163438.1-606s21c1
Sequence:CCGGATATAACCCAAATCGTCTAAGCTCGAGCTTAGACGATTTGGGTTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks