EMAIL THIS PAGE TO A FRIEND

SMIM14

small integral membrane protein 14

Synonyms: C4orf34
UniProtKB ID: Q96QK8
Gene ID:
Mouse(68552) small integral membrane protein 14
Rat(364154) small integral membrane protein 14
Zebrafish(402894) small integral membrane protein 14
dog(479105) small integral membrane protein 14
domestic guinea pig(100715520) small integral membrane protein 14
cow(614774) small integral membrane protein 14
119 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133697 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133697 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133697 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_174921 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174921 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174921 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174921 Rosetta Predictions human pricing
NM_001037792 Rosetta Predictions rat pricing
NM_133697 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174921 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174956 predicted 445
2 SASI_Hs01_00174957 predicted 203
3 SASI_Hs01_00174958 predicted 598
4 SASI_Hs01_00174960 predicted 317
5 SASI_Hs01_00174961 predicted 595
6 SASI_Hs01_00174962 predicted 779
7 SASI_Hs01_00174963 predicted 358
8 SASI_Hs02_00368845 predicted 723
9 SASI_Hs01_00174965 predicted 719
10 SASI_Hs02_00368846 predicted 290
11 SASI_Hs01_00174959 predicted 638
12 SASI_Hs01_00174964 predicted 638
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037792 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116699 predicted 481
2 SASI_Rn01_00116700 predicted 212
3 SASI_Rn02_00204619 predicted 480
4 SASI_Rn01_00116701 predicted 643
5 SASI_Rn02_00204620 predicted 485
6 SASI_Rn01_00116702 predicted 511
7 SASI_Rn01_00116706 predicted 654
8 SASI_Rn01_00116707 predicted 415
9 SASI_Rn02_00204621 predicted 568
10 SASI_Rn02_00204622 predicted 577
11 SASI_Rn01_00116703 predicted 215
12 SASI_Rn01_00116704 predicted 275
13 SASI_Rn01_00116705 predicted 229
14 SASI_Rn01_00116708 predicted 743
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133697 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198498 predicted 583
2 SASI_Mm01_00198499 predicted 213
3 SASI_Mm01_00198500 predicted 495
4 SASI_Mm01_00198501 predicted 619
5 SASI_Mm01_00198502 predicted 299
6 SASI_Mm01_00198503 predicted 232
7 SASI_Mm01_00198504 predicted 430
8 SASI_Mm01_00198505 predicted 642
9 SASI_Mm01_00198506 predicted 685
10 SASI_Mm01_00198507 predicted 449
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133697
SMIM14 MISSION shRNA Bacterial Glycerol Stock
small integral membrane protein 14
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133697.3-177s21c1
Sequence:CCGGCACGAACATGCTATGAGGAGGCTCGAGCCTCCTCATAGCATGTTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133697.3-327s21c1
Sequence:CCGGATGCTCCTCTTCCTTCTGAGGCTCGAGCCTCAGAAGGAAGAGGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133697.3-340s21c1
Sequence:CCGGTTCTGAGGCCTCCTAACCTGACTCGAGTCAGGTTAGGAGGCCTCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133697.3-430s21c1
Sequence:CCGGACTAACGTCCTGGTGTGGGAACTCGAGTTCCCACACCAGGACGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133697.3-190s21c1
Sequence:CCGGTGAGGAGGCTCATCAATCTGCCTCGAGGCAGATTGATGAGCCTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265035    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133697.3-593s21c1
Sequence:CCGGAGTTGCCACCGTCCTTATTTACTCGAGTAAATAAGGACGGTGGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133697.3-166s21c1
Sequence:CCGGGTGTCTGCTCTCACGAACATGCTCGAGCATGTTCGTGAGAGCAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377050    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133697.3-657s21c1
Sequence:CCGGTGTTGGTTGGCCTAAGCTTAACTCGAGTTAAGCTTAGGCCAACCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133697.3-223s21c1
Sequence:CCGGAGTCCTACTGCACCGACACAGCTCGAGCTGTGTCGGTGCAGTAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174635    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133697.1-520s1c1
Sequence:CCGGGCAGTTTGGATGGTATTGTTTCTCGAGAAACAATACCATCCAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174401    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133697.1-594s1c1
Sequence:CCGGCACCGTCCTTATTTACAGTATCTCGAGATACTGTAAATAAGGACGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133697.1-167s1c1
Sequence:CCGGGCTCTCACGAACATGCTATGACTCGAGTCATAGCATGTTCGTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133697
SMIM14 MISSION shRNA shRNA Plasmid DNA
small integral membrane protein 14
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133697.3-177s21c1
Sequence:CCGGCACGAACATGCTATGAGGAGGCTCGAGCCTCCTCATAGCATGTTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133697.3-327s21c1
Sequence:CCGGATGCTCCTCTTCCTTCTGAGGCTCGAGCCTCAGAAGGAAGAGGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133697.3-340s21c1
Sequence:CCGGTTCTGAGGCCTCCTAACCTGACTCGAGTCAGGTTAGGAGGCCTCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133697.3-430s21c1
Sequence:CCGGACTAACGTCCTGGTGTGGGAACTCGAGTTCCCACACCAGGACGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133697.3-190s21c1
Sequence:CCGGTGAGGAGGCTCATCAATCTGCCTCGAGGCAGATTGATGAGCCTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265035    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133697.3-593s21c1
Sequence:CCGGAGTTGCCACCGTCCTTATTTACTCGAGTAAATAAGGACGGTGGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133697.3-166s21c1
Sequence:CCGGGTGTCTGCTCTCACGAACATGCTCGAGCATGTTCGTGAGAGCAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377050    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133697.3-657s21c1
Sequence:CCGGTGTTGGTTGGCCTAAGCTTAACTCGAGTTAAGCTTAGGCCAACCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133697.3-223s21c1
Sequence:CCGGAGTCCTACTGCACCGACACAGCTCGAGCTGTGTCGGTGCAGTAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174635    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133697.1-520s1c1
Sequence:CCGGGCAGTTTGGATGGTATTGTTTCTCGAGAAACAATACCATCCAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174401    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133697.1-594s1c1
Sequence:CCGGCACCGTCCTTATTTACAGTATCTCGAGATACTGTAAATAAGGACGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133697.1-167s1c1
Sequence:CCGGGCTCTCACGAACATGCTATGACTCGAGTCATAGCATGTTCGTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133697
SMIM14 MISSION shRNA Lentiviral Transduction Particles
small integral membrane protein 14
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133697.3-177s21c1
Sequence:CCGGCACGAACATGCTATGAGGAGGCTCGAGCCTCCTCATAGCATGTTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133697.3-327s21c1
Sequence:CCGGATGCTCCTCTTCCTTCTGAGGCTCGAGCCTCAGAAGGAAGAGGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133697.3-340s21c1
Sequence:CCGGTTCTGAGGCCTCCTAACCTGACTCGAGTCAGGTTAGGAGGCCTCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133697.3-430s21c1
Sequence:CCGGACTAACGTCCTGGTGTGGGAACTCGAGTTCCCACACCAGGACGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133697.3-190s21c1
Sequence:CCGGTGAGGAGGCTCATCAATCTGCCTCGAGGCAGATTGATGAGCCTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265035    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133697.3-593s21c1
Sequence:CCGGAGTTGCCACCGTCCTTATTTACTCGAGTAAATAAGGACGGTGGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133697.3-166s21c1
Sequence:CCGGGTGTCTGCTCTCACGAACATGCTCGAGCATGTTCGTGAGAGCAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377050    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133697.3-657s21c1
Sequence:CCGGTGTTGGTTGGCCTAAGCTTAACTCGAGTTAAGCTTAGGCCAACCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133697.3-223s21c1
Sequence:CCGGAGTCCTACTGCACCGACACAGCTCGAGCTGTGTCGGTGCAGTAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174635    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133697.1-520s1c1
Sequence:CCGGGCAGTTTGGATGGTATTGTTTCTCGAGAAACAATACCATCCAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174401    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133697.1-594s1c1
Sequence:CCGGCACCGTCCTTATTTACAGTATCTCGAGATACTGTAAATAAGGACGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133697.1-167s1c1
Sequence:CCGGGCTCTCACGAACATGCTATGACTCGAGTCATAGCATGTTCGTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174921
VALIDATED
SMIM14 MISSION shRNA Bacterial Glycerol Stock
small integral membrane protein 14
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145399    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_174921.1-1164s1c1
Sequence:CCGGGCAGATGATTTACAGTCCATTCTCGAGAATGGACTGTAAATCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174921.1-215s1c1
Sequence:CCGGGAGAAGACTGATCAATCTGTTCTCGAGAACAGATTGATCAGTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174921.1-199s1c1
Sequence:CCGGCTCATGAACATGCAATGAGAACTCGAGTTCTCATTGCATGTTCATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_174921.1-186s1c1
Sequence:CCGGGAATGTGTTTGCTCTCATGAACTCGAGTTCATGAGAGCAAACACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142869    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174921.1-413s1c1
Sequence:CCGGCAGTCCTCATAATGGACAAGACTCGAGTCTTGTCCATTATGAGGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174921.1-292s1c1
Sequence:CCGGCCTCTGGTGATAATGGCATCACTCGAGTGATGCCATTATCACCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174921.1-417s1c1
Sequence:CCGGCCTCATAATGGACAAGATCCACTCGAGTGGATCTTGTCCATTATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174921.1-403s1c1
Sequence:CCGGGAAAGCCAACCAGTCCTCATACTCGAGTATGAGGACTGGTTGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_174921.1-326s1c1
Sequence:CCGGCTTGGTAGCCTGGATGGTTATCTCGAGATAACCATCCAGGCTACCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140949    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174921.1-506s1c1
Sequence:CCGGCGAACGAAGATGACCAGAGTACTCGAGTACTCTGGTCATCTTCGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_174921.1-196s1c1
Sequence:CCGGGCTCTCATGAACATGCAATGACTCGAGTCATTGCATGTTCATGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174921
VALIDATED
SMIM14 MISSION shRNA shRNA Plasmid DNA
small integral membrane protein 14
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145399    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_174921.1-1164s1c1
Sequence:CCGGGCAGATGATTTACAGTCCATTCTCGAGAATGGACTGTAAATCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174921.1-215s1c1
Sequence:CCGGGAGAAGACTGATCAATCTGTTCTCGAGAACAGATTGATCAGTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174921.1-199s1c1
Sequence:CCGGCTCATGAACATGCAATGAGAACTCGAGTTCTCATTGCATGTTCATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_174921.1-186s1c1
Sequence:CCGGGAATGTGTTTGCTCTCATGAACTCGAGTTCATGAGAGCAAACACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142869    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174921.1-413s1c1
Sequence:CCGGCAGTCCTCATAATGGACAAGACTCGAGTCTTGTCCATTATGAGGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174921.1-292s1c1
Sequence:CCGGCCTCTGGTGATAATGGCATCACTCGAGTGATGCCATTATCACCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174921.1-417s1c1
Sequence:CCGGCCTCATAATGGACAAGATCCACTCGAGTGGATCTTGTCCATTATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174921.1-403s1c1
Sequence:CCGGGAAAGCCAACCAGTCCTCATACTCGAGTATGAGGACTGGTTGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_174921.1-326s1c1
Sequence:CCGGCTTGGTAGCCTGGATGGTTATCTCGAGATAACCATCCAGGCTACCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140949    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174921.1-506s1c1
Sequence:CCGGCGAACGAAGATGACCAGAGTACTCGAGTACTCTGGTCATCTTCGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_174921.1-196s1c1
Sequence:CCGGGCTCTCATGAACATGCAATGACTCGAGTCATTGCATGTTCATGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174921
VALIDATED
SMIM14 MISSION shRNA Lentiviral Transduction Particles
small integral membrane protein 14
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145399    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_174921.1-1164s1c1
Sequence:CCGGGCAGATGATTTACAGTCCATTCTCGAGAATGGACTGTAAATCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174921.1-215s1c1
Sequence:CCGGGAGAAGACTGATCAATCTGTTCTCGAGAACAGATTGATCAGTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174921.1-199s1c1
Sequence:CCGGCTCATGAACATGCAATGAGAACTCGAGTTCTCATTGCATGTTCATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_174921.1-186s1c1
Sequence:CCGGGAATGTGTTTGCTCTCATGAACTCGAGTTCATGAGAGCAAACACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142869    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174921.1-413s1c1
Sequence:CCGGCAGTCCTCATAATGGACAAGACTCGAGTCTTGTCCATTATGAGGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174921.1-292s1c1
Sequence:CCGGCCTCTGGTGATAATGGCATCACTCGAGTGATGCCATTATCACCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174921.1-417s1c1
Sequence:CCGGCCTCATAATGGACAAGATCCACTCGAGTGGATCTTGTCCATTATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174921.1-403s1c1
Sequence:CCGGGAAAGCCAACCAGTCCTCATACTCGAGTATGAGGACTGGTTGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_174921.1-326s1c1
Sequence:CCGGCTTGGTAGCCTGGATGGTTATCTCGAGATAACCATCCAGGCTACCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140949    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174921.1-506s1c1
Sequence:CCGGCGAACGAAGATGACCAGAGTACTCGAGTACTCTGGTCATCTTCGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_174921.1-196s1c1
Sequence:CCGGGCTCTCATGAACATGCAATGACTCGAGTCATTGCATGTTCATGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks