EMAIL THIS PAGE TO A FRIEND

SMIM20

small integral membrane protein 20

Synonyms: C4orf52
UniProtKB ID: Q8N5G0, C9JYT8, Q9BRT5
Gene ID:
Mouse(66278) small integral membrane protein 20
Rat(501923) small integral membrane protein 20
dog(611690) small integral membrane protein 20
cow(615093) small integral membrane protein 20
domestic guinea pig(100720422) small integral membrane protein 20
naked mole-rat(101697723) small integral membrane protein 20
82 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA016552 Anti-SMIM20 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145432 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145432 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145432 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001145433 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001145433 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001145433 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU203761 MISSION® esiRNA esiRNA targeting mouse 1810013D10Rik mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_371691 Rosetta Predictions human pricing
XR_040593 Rosetta Predictions human pricing
XR_040594 Rosetta Predictions human pricing
XR_040595 Rosetta Predictions human pricing
NM_001134639 Rosetta Predictions rat pricing
XM_913511 Rosetta Predictions mouse pricing
XM_983179 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371691 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00264107 predicted 190
2 SASI_Hs01_00264108 predicted 283
3 SASI_Hs01_00264109 predicted 263
4 SASI_Hs01_00264110 predicted 244
5 SASI_Hs01_00264111 predicted 236
6 SASI_Hs01_00264112 predicted 201
7 SASI_Hs01_00264113 predicted 152
8 SASI_Hs01_00264114 predicted 134
9 SASI_Hs01_00264115 predicted 241
10 SASI_Hs01_00264116 predicted 66
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040593 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00520245 predicted 822
2 SASI_Hs02_00520246 predicted 810
3 SASI_Hs02_00520247 predicted 804
4 SASI_Hs02_00520248 predicted 893
5 SASI_Hs02_00520249 predicted 942
6 SASI_Hs02_00520250 predicted 847
7 SASI_Hs02_00520251 predicted 941
8 SASI_Hs02_00520252 predicted 529
9 SASI_Hs02_00520253 predicted 672
10 SASI_Hs02_00520254 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040594 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00520255 predicted 824
2 SASI_Hs02_00520256 predicted 812
3 SASI_Hs02_00520257 predicted 803
4 SASI_Hs02_00520258 predicted 894
5 SASI_Hs02_00520259 predicted 945
6 SASI_Hs02_00520260 predicted 848
7 SASI_Hs02_00520261 predicted 946
8 SASI_Hs02_00520262 predicted 525
9 SASI_Hs02_00520263 predicted 680
10 SASI_Hs02_00520264 predicted 377
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040595 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00520265 predicted 817
2 SASI_Hs02_00520266 predicted 812
3 SASI_Hs02_00520267 predicted 803
4 SASI_Hs02_00520268 predicted 899
5 SASI_Hs02_00520269 predicted 943
6 SASI_Hs02_00520270 predicted 847
7 SASI_Hs02_00520271 predicted 944
8 SASI_Hs02_00520272 predicted 530
9 SASI_Hs02_00520273 predicted 677
10 SASI_Hs02_00520274 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134639 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257869 predicted 571
2 SASI_Rn02_00257870 predicted 739
3 SASI_Rn02_00257871 predicted 888
4 SASI_Rn02_00257872 predicted 501
5 SASI_Rn02_00257873 predicted 806
6 SASI_Rn02_00257874 predicted 790
7 SASI_Rn02_00257875 predicted 751
8 SASI_Rn02_00257876 predicted 602
9 SASI_Rn02_00257877 predicted 822
10 SASI_Rn02_00257878 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_913511 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00437725 predicted 276
2 SASI_Mm02_00437726 predicted 400
3 SASI_Mm02_00437727 predicted 796
4 SASI_Mm02_00437728 predicted 598
5 SASI_Mm02_00437729 predicted 624
6 SASI_Mm02_00437730 predicted 412
7 SASI_Mm02_00437731 predicted 367
8 SASI_Mm02_00437732 predicted 320
9 SASI_Mm02_00437733 predicted 732
10 SASI_Mm02_00437734 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_983179 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00203417 predicted 278
2 SASI_Mm01_00203418 predicted 392
3 SASI_Mm01_00203419 predicted 798
4 SASI_Mm02_00448049 predicted 596
5 SASI_Mm01_00203422 predicted 616
6 SASI_Mm01_00203423 predicted 412
7 SASI_Mm01_00203424 predicted 371
8 SASI_Mm02_00448050 predicted 318
9 SASI_Mm01_00203425 predicted 741
10 SASI_Mm01_00203426 predicted 387
11 SASI_Mm01_00203420 predicted 560
12 SASI_Mm01_00203421 predicted 774
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145432
VALIDATED
SMIM20 MISSION shRNA Bacterial Glycerol Stock
small integral membrane protein 20
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001145432.1-274s21c1
Sequence:CCGGATGTGCAGCCACCAGGGTTAACTCGAGTTAACCCTGGTGGCTGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352315    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001145432.1-520s21c1
Sequence:CCGGTGGAACAAATTATACCATTAGCTCGAGCTAATGGTATAATTTGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145432.1-304s21c1
Sequence:CCGGCTGATCCATTTGGCAGGAAATCTCGAGATTTCCTGCCAAATGGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001145432.1-229s21c1
Sequence:CCGGACAAGAAGGAACAAGCTATAACTCGAGTTATAGCTTGTTCCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001145432.1-183s21c1
Sequence:CCGGGCCTTCTATCCCATCTACTTCCTCGAGGAAGTAGATGGGATAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145432
VALIDATED
SMIM20 MISSION shRNA shRNA Plasmid DNA
small integral membrane protein 20
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001145432.1-274s21c1
Sequence:CCGGATGTGCAGCCACCAGGGTTAACTCGAGTTAACCCTGGTGGCTGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352315    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001145432.1-520s21c1
Sequence:CCGGTGGAACAAATTATACCATTAGCTCGAGCTAATGGTATAATTTGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145432.1-304s21c1
Sequence:CCGGCTGATCCATTTGGCAGGAAATCTCGAGATTTCCTGCCAAATGGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001145432.1-229s21c1
Sequence:CCGGACAAGAAGGAACAAGCTATAACTCGAGTTATAGCTTGTTCCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001145432.1-183s21c1
Sequence:CCGGGCCTTCTATCCCATCTACTTCCTCGAGGAAGTAGATGGGATAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145432
VALIDATED
SMIM20 MISSION shRNA Lentiviral Transduction Particles
small integral membrane protein 20
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001145432.1-274s21c1
Sequence:CCGGATGTGCAGCCACCAGGGTTAACTCGAGTTAACCCTGGTGGCTGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352315    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001145432.1-520s21c1
Sequence:CCGGTGGAACAAATTATACCATTAGCTCGAGCTAATGGTATAATTTGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145432.1-304s21c1
Sequence:CCGGCTGATCCATTTGGCAGGAAATCTCGAGATTTCCTGCCAAATGGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001145432.1-229s21c1
Sequence:CCGGACAAGAAGGAACAAGCTATAACTCGAGTTATAGCTTGTTCCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001145432.1-183s21c1
Sequence:CCGGGCCTTCTATCCCATCTACTTCCTCGAGGAAGTAGATGGGATAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145433
VALIDATED
SMIM20 MISSION shRNA Bacterial Glycerol Stock
small integral membrane protein 20
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001145433.1-167s21c1
Sequence:CCGGCGCTCATATTCGGAGGCTTCACTCGAGTGAAGCCTCCGAATATGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145433.1-326s21c1
Sequence:CCGGCTGATCCATTTGGCAGGAAATCTCGAGATTTCCTGCCAAATGGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145433.1-231s21c1
Sequence:CCGGCCTTATGCGGCTGGAGGAATACTCGAGTATTCCTCCAGCCGCATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001145433.1-254s21c1
Sequence:CCGGAGAAGGAGCAGGCTGTAAATCCTCGAGGATTTACAGCCTGCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347006    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001145433.1-367s21c1
Sequence:CCGGTGAGGAAAGTGGACGTCTTTACTCGAGTAAAGACGTCCACTTTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145433
VALIDATED
SMIM20 MISSION shRNA shRNA Plasmid DNA
small integral membrane protein 20
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001145433.1-167s21c1
Sequence:CCGGCGCTCATATTCGGAGGCTTCACTCGAGTGAAGCCTCCGAATATGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145433.1-326s21c1
Sequence:CCGGCTGATCCATTTGGCAGGAAATCTCGAGATTTCCTGCCAAATGGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145433.1-231s21c1
Sequence:CCGGCCTTATGCGGCTGGAGGAATACTCGAGTATTCCTCCAGCCGCATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001145433.1-254s21c1
Sequence:CCGGAGAAGGAGCAGGCTGTAAATCCTCGAGGATTTACAGCCTGCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347006    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001145433.1-367s21c1
Sequence:CCGGTGAGGAAAGTGGACGTCTTTACTCGAGTAAAGACGTCCACTTTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145433
VALIDATED
SMIM20 MISSION shRNA Lentiviral Transduction Particles
small integral membrane protein 20
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001145433.1-167s21c1
Sequence:CCGGCGCTCATATTCGGAGGCTTCACTCGAGTGAAGCCTCCGAATATGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145433.1-326s21c1
Sequence:CCGGCTGATCCATTTGGCAGGAAATCTCGAGATTTCCTGCCAAATGGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145433.1-231s21c1
Sequence:CCGGCCTTATGCGGCTGGAGGAATACTCGAGTATTCCTCCAGCCGCATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001145433.1-254s21c1
Sequence:CCGGAGAAGGAGCAGGCTGTAAATCCTCGAGGATTTACAGCCTGCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347006    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001145433.1-367s21c1
Sequence:CCGGTGAGGAAAGTGGACGTCTTTACTCGAGTAAAGACGTCCACTTTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks