EMAIL THIS PAGE TO A FRIEND

SMIM3

small integral membrane protein 3

Synonyms: C5orf62 MST150 NID67
UniProtKB ID: Q9BZL3, Q3MIG3, Q6ZUV4
Gene ID:
Mouse(106878) small integral membrane protein 3
Rat(286910) small integral membrane protein 3
sheep(101103892) small integral membrane protein 3
naked mole-rat(101698125) small integral membrane protein 3
domestic guinea pig(100729489) small integral membrane protein 3
dog(100684301) small integral membrane protein 3
domestic cat(101081955) small integral membrane protein 3
187 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134133 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134133 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134133 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032947 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032947 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032947 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU072541 MISSION® esiRNA esiRNA targeting mouse 2010002N04Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032947 Rosetta Predictions human pricing
NM_173126 Rosetta Predictions rat pricing
NM_134133 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032947 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221038 predicted 712
2 SASI_Hs01_00221040 predicted 676
3 SASI_Hs01_00221041 predicted 1146
4 SASI_Hs02_00360570 predicted 1142
5 SASI_Hs01_00221045 predicted 1215
6 SASI_Hs02_00360571 predicted 1325
7 SASI_Hs01_00221047 predicted 1198
8 SASI_Hs02_00360572 predicted 1914
9 SASI_Hs02_00360573 predicted 1878
10 SASI_Hs02_00360574 predicted 1641
11 SASI_Hs01_00221039 predicted 657
12 SASI_Hs01_00221042 predicted 1143
13 SASI_Hs01_00221043 predicted 1531
14 SASI_Hs01_00221044 predicted 1845
15 SASI_Hs01_00221046 predicted 1776
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173126 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050396 predicted 615
2 SASI_Rn01_00050397 predicted 700
3 SASI_Rn01_00050398 predicted 685
4 SASI_Rn01_00050399 predicted 479
5 SASI_Rn01_00050400 predicted 705
6 SASI_Rn01_00050401 predicted 670
7 SASI_Rn01_00050402 predicted 535
8 SASI_Rn01_00050403 predicted 654
9 SASI_Rn01_00050405 predicted 680
10 SASI_Rn02_00269294 predicted 622
11 SASI_Rn01_00050404 predicted 818
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134133 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155083 predicted 868
2 SASI_Mm01_00155084 predicted 690
3 SASI_Mm01_00155085 predicted 727
4 SASI_Mm02_00339378 predicted 1006
5 SASI_Mm01_00155086 predicted 1272
6 SASI_Mm01_00155087 predicted 1052
7 SASI_Mm01_00155088 predicted 898
8 SASI_Mm01_00155089 predicted 1005
9 SASI_Mm01_00155090 predicted 1059
10 SASI_Mm01_00155091 predicted 689
11 SASI_Mm01_00155092 predicted 418
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134133
VALIDATED
SMIM3 MISSION shRNA Bacterial Glycerol Stock
small integral membrane protein 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176099    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134133.1-411s1c1
Sequence:CCGGGACCTGGATTTGTGCTTTAATCTCGAGATTAAAGCACAAATCCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134133.1-236s1c1
Sequence:CCGGCATCATGACCTCCTTGTTTCTCTCGAGAGAAACAAGGAGGTCATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134133.1-230s1c1
Sequence:CCGGCATTGTCATCATGACCTCCTTCTCGAGAAGGAGGTCATGATGACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134133.2-650s21c1
Sequence:CCGGCTGGATATCTGGGCCATAGTCCTCGAGGACTATGGCCCAGATATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134133.2-693s21c1
Sequence:CCGGTCATCATGACCTCCTTGTTTCCTCGAGGAAACAAGGAGGTCATGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134133.2-599s21c1
Sequence:CCGGATGGACGCTATCACCCAATCCCTCGAGGGATTGGGTGATAGCGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134133.2-723s21c1
Sequence:CCGGCCACTGCGGTCATCATCTATCCTCGAGGATAGATGATGACCGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134133.2-1699s21c1
Sequence:CCGGTTAAGACAACGACGGTTATTTCTCGAGAAATAACCGTCGTTGTCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134133
VALIDATED
SMIM3 MISSION shRNA shRNA Plasmid DNA
small integral membrane protein 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176099    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134133.1-411s1c1
Sequence:CCGGGACCTGGATTTGTGCTTTAATCTCGAGATTAAAGCACAAATCCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134133.1-236s1c1
Sequence:CCGGCATCATGACCTCCTTGTTTCTCTCGAGAGAAACAAGGAGGTCATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134133.1-230s1c1
Sequence:CCGGCATTGTCATCATGACCTCCTTCTCGAGAAGGAGGTCATGATGACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134133.2-650s21c1
Sequence:CCGGCTGGATATCTGGGCCATAGTCCTCGAGGACTATGGCCCAGATATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134133.2-693s21c1
Sequence:CCGGTCATCATGACCTCCTTGTTTCCTCGAGGAAACAAGGAGGTCATGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134133.2-599s21c1
Sequence:CCGGATGGACGCTATCACCCAATCCCTCGAGGGATTGGGTGATAGCGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134133.2-723s21c1
Sequence:CCGGCCACTGCGGTCATCATCTATCCTCGAGGATAGATGATGACCGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134133.2-1699s21c1
Sequence:CCGGTTAAGACAACGACGGTTATTTCTCGAGAAATAACCGTCGTTGTCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134133
VALIDATED
SMIM3 MISSION shRNA Lentiviral Transduction Particles
small integral membrane protein 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176099    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134133.1-411s1c1
Sequence:CCGGGACCTGGATTTGTGCTTTAATCTCGAGATTAAAGCACAAATCCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134133.1-236s1c1
Sequence:CCGGCATCATGACCTCCTTGTTTCTCTCGAGAGAAACAAGGAGGTCATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134133.1-230s1c1
Sequence:CCGGCATTGTCATCATGACCTCCTTCTCGAGAAGGAGGTCATGATGACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134133.2-650s21c1
Sequence:CCGGCTGGATATCTGGGCCATAGTCCTCGAGGACTATGGCCCAGATATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134133.2-693s21c1
Sequence:CCGGTCATCATGACCTCCTTGTTTCCTCGAGGAAACAAGGAGGTCATGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134133.2-599s21c1
Sequence:CCGGATGGACGCTATCACCCAATCCCTCGAGGGATTGGGTGATAGCGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134133.2-723s21c1
Sequence:CCGGCCACTGCGGTCATCATCTATCCTCGAGGATAGATGATGACCGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134133.2-1699s21c1
Sequence:CCGGTTAAGACAACGACGGTTATTTCTCGAGAAATAACCGTCGTTGTCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032947
VALIDATED
SMIM3 MISSION shRNA Bacterial Glycerol Stock
small integral membrane protein 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008668    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032947.3-1149s1c1
Sequence:CCGGCCACAGATATAAGGGTGTTATCTCGAGATAACACCCTTATATCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032947.3-331s1c1
Sequence:CCGGCCCTTCTCTCGCAGGTTCCTTCTCGAGAAGGAACCTGCGAGAGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032947.3-624s1c1
Sequence:CCGGCCATCCCTGACCCAGGAACTTCTCGAGAAGTTCCTGGGTCAGGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032947.3-634s1c1
Sequence:CCGGCCCAGGAACTTTCCGCAGACTCTCGAGAGTCTGCGGAAAGTTCCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032947.3-449s1c1
Sequence:CCGGCCGCGCATTCCAGAGCCAGCACTCGAGTGCTGGCTCTGGAATGCGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032947.3-666s21c1
Sequence:CCGGGGGAGTGAAGCAACATGGATGCTCGAGCATCCATGTTGCTTCACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032947.3-1094s21c1
Sequence:CCGGTGTGAGAACCACCTGACTTAGCTCGAGCTAAGTCAGGTGGTTCTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414489    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032947.3-1062s21c1
Sequence:CCGGTGGTGATCCCTGCCCTTTCTACTCGAGTAGAAAGGGCAGGGATCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032947.3-772s21c1
Sequence:CCGGTGTCATCATGACCTCGTTGTTCTCGAGAACAACGAGGTCATGATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032947.3-1172s21c1
Sequence:CCGGTGAATCCTGAGAAGCTTTCAACTCGAGTTGAAAGCTTCTCAGGATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032947
VALIDATED
SMIM3 MISSION shRNA shRNA Plasmid DNA
small integral membrane protein 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008668    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032947.3-1149s1c1
Sequence:CCGGCCACAGATATAAGGGTGTTATCTCGAGATAACACCCTTATATCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032947.3-331s1c1
Sequence:CCGGCCCTTCTCTCGCAGGTTCCTTCTCGAGAAGGAACCTGCGAGAGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032947.3-624s1c1
Sequence:CCGGCCATCCCTGACCCAGGAACTTCTCGAGAAGTTCCTGGGTCAGGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032947.3-634s1c1
Sequence:CCGGCCCAGGAACTTTCCGCAGACTCTCGAGAGTCTGCGGAAAGTTCCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032947.3-449s1c1
Sequence:CCGGCCGCGCATTCCAGAGCCAGCACTCGAGTGCTGGCTCTGGAATGCGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032947.3-666s21c1
Sequence:CCGGGGGAGTGAAGCAACATGGATGCTCGAGCATCCATGTTGCTTCACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032947.3-1094s21c1
Sequence:CCGGTGTGAGAACCACCTGACTTAGCTCGAGCTAAGTCAGGTGGTTCTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414489    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032947.3-1062s21c1
Sequence:CCGGTGGTGATCCCTGCCCTTTCTACTCGAGTAGAAAGGGCAGGGATCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032947.3-772s21c1
Sequence:CCGGTGTCATCATGACCTCGTTGTTCTCGAGAACAACGAGGTCATGATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032947.3-1172s21c1
Sequence:CCGGTGAATCCTGAGAAGCTTTCAACTCGAGTTGAAAGCTTCTCAGGATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032947
VALIDATED
SMIM3 MISSION shRNA Lentiviral Transduction Particles
small integral membrane protein 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008668    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032947.3-1149s1c1
Sequence:CCGGCCACAGATATAAGGGTGTTATCTCGAGATAACACCCTTATATCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032947.3-331s1c1
Sequence:CCGGCCCTTCTCTCGCAGGTTCCTTCTCGAGAAGGAACCTGCGAGAGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032947.3-624s1c1
Sequence:CCGGCCATCCCTGACCCAGGAACTTCTCGAGAAGTTCCTGGGTCAGGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032947.3-634s1c1
Sequence:CCGGCCCAGGAACTTTCCGCAGACTCTCGAGAGTCTGCGGAAAGTTCCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032947.3-449s1c1
Sequence:CCGGCCGCGCATTCCAGAGCCAGCACTCGAGTGCTGGCTCTGGAATGCGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032947.3-666s21c1
Sequence:CCGGGGGAGTGAAGCAACATGGATGCTCGAGCATCCATGTTGCTTCACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032947.3-1094s21c1
Sequence:CCGGTGTGAGAACCACCTGACTTAGCTCGAGCTAAGTCAGGTGGTTCTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414489    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032947.3-1062s21c1
Sequence:CCGGTGGTGATCCCTGCCCTTTCTACTCGAGTAGAAAGGGCAGGGATCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032947.3-772s21c1
Sequence:CCGGTGTCATCATGACCTCGTTGTTCTCGAGAACAACGAGGTCATGATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032947.3-1172s21c1
Sequence:CCGGTGAATCCTGAGAAGCTTTCAACTCGAGTTGAAAGCTTCTCAGGATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks