EMAIL THIS PAGE TO A FRIEND

SMIM4

small integral membrane protein 4

Synonyms: C3orf78
UniProtKB ID: Q8WVI0
Gene ID:
Mouse(66487) small itegral membrane protein 4
Rat(361111) small integral membrane protein 4
domestic cat(101084012) small integral membrane protein 4
domestic guinea pig(100728772) small integral membrane protein 4
naked mole-rat(101699795) small integral membrane protein 4
cow(782900) small integral membrane protein 4
sheep(101110881) small integral membrane protein 4
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA047771 Anti-SMIM4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001124767 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001124767 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001124767 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001124767 Rosetta Predictions human pricing
XM_496644 Rosetta Predictions human pricing
XM_001062546 Rosetta Predictions rat pricing
XM_341397 Rosetta Predictions rat pricing
NR_024069 Rosetta Predictions mouse pricing
XM_619218 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001124767 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327974 predicted 219
2 SASI_Hs02_00327975 predicted 207
3 SASI_Hs02_00327976 predicted 212
4 SASI_Hs02_00327977 predicted 203
5 SASI_Hs02_00327978 predicted 282
6 SASI_Hs02_00327979 predicted 401
7 SASI_Hs02_00327980 predicted 367
8 SASI_Hs02_00327981 predicted 275
9 SASI_Hs02_00327982 predicted 363
10 SASI_Hs02_00327983 predicted 245
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_496644 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00283872 predicted 643
2 SASI_Hs01_00283873 predicted 301
3 SASI_Hs01_00283874 predicted 556
4 SASI_Hs01_00283875 predicted 448
5 SASI_Hs01_00283876 predicted 565
6 SASI_Hs01_00283877 predicted 554
7 SASI_Hs01_00283878 predicted 438
8 SASI_Hs01_00283879 predicted 486
9 SASI_Hs01_00283880 predicted 553
10 SASI_Hs01_00283881 predicted 646
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062546 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00303783 predicted 201
2 SASI_Rn02_00303784 predicted 240
3 SASI_Rn02_00303785 predicted 208
4 SASI_Rn02_00303786 predicted 237
5 SASI_Rn02_00303787 predicted 244
6 SASI_Rn02_00303788 predicted 240
7 SASI_Rn02_00303789 predicted 258
8 SASI_Rn02_00303790 predicted 435
9 SASI_Rn02_00303791 predicted 287
10 SASI_Rn02_00303792 predicted 11
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341397 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392858 predicted 208
2 SASI_Rn02_00392859 predicted 240
3 SASI_Rn02_00392860 predicted 207
4 SASI_Rn02_00392861 predicted 235
5 SASI_Rn02_00392862 predicted 245
6 SASI_Rn02_00392863 predicted 237
7 SASI_Rn02_00392864 predicted 260
8 SASI_Rn02_00392865 predicted 443
9 SASI_Rn02_00392866 predicted 286
10 SASI_Rn02_00392867 predicted 15
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_024069 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00354518 predicted 3934
2 SASI_Mm02_00354519 predicted 201
3 SASI_Mm02_00354520 predicted 3918
4 SASI_Mm02_00354521 predicted 3392
5 SASI_Mm02_00354522 predicted 1582
6 SASI_Mm02_00354523 predicted 2042
7 SASI_Mm02_00354524 predicted 3536
8 SASI_Mm02_00354525 predicted 1763
9 SASI_Mm02_00354526 predicted 1700
10 SASI_Mm02_00354527 predicted 3949
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619218 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00274493 predicted 209
2 SASI_Mm01_00274494 predicted 246
3 SASI_Mm01_00274495 predicted 282
4 SASI_Mm01_00274496 predicted 238
5 SASI_Mm01_00274497 predicted 186
6 SASI_Mm01_00274498 predicted 350
7 SASI_Mm01_00274499 predicted 164
8 SASI_Mm01_00274500 predicted 364
9 SASI_Mm01_00274501 predicted 349
10 SASI_Mm01_00274502 predicted 273
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001124767
VALIDATED
SMIM4 MISSION shRNA Bacterial Glycerol Stock
small integral membrane protein 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001124767.1-199s21c1
Sequence:CCGGGAAGCAGCGATTTGGCATCTACTCGAGTAGATGCCAAATCGCTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001124767.1-239s21c1
Sequence:CCGGTTTGTCCTGGGAGGAACGATGCTCGAGCATCGTTCCTCCCAGGACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001124767.1-218s21c1
Sequence:CCGGTACCGGTTCCTGCCCTTCTTTCTCGAGAAAGAAGGGCAGGAACCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001124767.1-257s21c1
Sequence:CCGGATGGAGTGGATCATGATTAAACTCGAGTTTAATCATGATCCACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001124767.1-292s21c1
Sequence:CCGGGGAGACCTTCTATGATGTCTACTCGAGTAGACATCATAGAAGGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001124767
VALIDATED
SMIM4 MISSION shRNA shRNA Plasmid DNA
small integral membrane protein 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001124767.1-199s21c1
Sequence:CCGGGAAGCAGCGATTTGGCATCTACTCGAGTAGATGCCAAATCGCTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001124767.1-239s21c1
Sequence:CCGGTTTGTCCTGGGAGGAACGATGCTCGAGCATCGTTCCTCCCAGGACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001124767.1-218s21c1
Sequence:CCGGTACCGGTTCCTGCCCTTCTTTCTCGAGAAAGAAGGGCAGGAACCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001124767.1-257s21c1
Sequence:CCGGATGGAGTGGATCATGATTAAACTCGAGTTTAATCATGATCCACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001124767.1-292s21c1
Sequence:CCGGGGAGACCTTCTATGATGTCTACTCGAGTAGACATCATAGAAGGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001124767
VALIDATED
SMIM4 MISSION shRNA Lentiviral Transduction Particles
small integral membrane protein 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001124767.1-199s21c1
Sequence:CCGGGAAGCAGCGATTTGGCATCTACTCGAGTAGATGCCAAATCGCTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001124767.1-239s21c1
Sequence:CCGGTTTGTCCTGGGAGGAACGATGCTCGAGCATCGTTCCTCCCAGGACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001124767.1-218s21c1
Sequence:CCGGTACCGGTTCCTGCCCTTCTTTCTCGAGAAAGAAGGGCAGGAACCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001124767.1-257s21c1
Sequence:CCGGATGGAGTGGATCATGATTAAACTCGAGTTTAATCATGATCCACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001124767.1-292s21c1
Sequence:CCGGGGAGACCTTCTATGATGTCTACTCGAGTAGACATCATAGAAGGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks