EMAIL THIS PAGE TO A FRIEND

SMPD4

sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3)

Synonyms: NET13 NSMASE-3 NSMASE3
Gene ID:
Human(55627) Summary: Sphingomyelinases (EC 3.1.4.12), such as SMPD4, catalyze the hydrolysis of membrane sphingomyelin to form phosphorylcholine and ceramide (Krut et al., 2006 [PubMed 16517606]
Mouse(77626) sphingomyelin phosphodiesterase 4
Rat(303790) sphingomyelin phosphodiesterase 4, neutral membrane
cow(507207) sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3)
domestic guinea pig(100733553) sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3)
naked mole-rat(101699020) sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3)
Domestic Rabbit(100350219) sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3)
Zebrafish(793294) sphingomyelin phosphodiesterase 4
Horse(100052086) sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3)
domestic cat(101100196) sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3)
dog(486434) sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3)
chicken(416942) sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3)
83 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029945 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029945 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029945 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017751 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017751 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017751 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017751 Rosetta Predictions human pricing
NM_017951 Rosetta Predictions human pricing
XM_001058775 Rosetta Predictions rat pricing
XM_001063553 Rosetta Predictions rat pricing
NM_029945 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017751 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021170 predicted 2306
2 SASI_Hs01_00021172 predicted 629
3 SASI_Hs01_00021173 predicted 753
4 SASI_Hs01_00021174 predicted 921
5 SASI_Hs01_00021175 predicted 1874
6 SASI_Hs01_00021176 predicted 716
7 SASI_Hs01_00021177 predicted 685
8 SASI_Hs01_00021179 predicted 1167
9 SASI_Hs02_00350562 predicted 2898
10 SASI_Hs02_00350563 predicted 656
11 SASI_Hs01_00021171 predicted 914
12 SASI_Hs01_00021178 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017951 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199966 predicted 2395
2 SASI_Hs01_00199968 predicted 631
3 SASI_Hs01_00199969 predicted 758
4 SASI_Hs01_00199970 predicted 915
5 SASI_Hs01_00199971 predicted 1959
6 SASI_Hs01_00199972 predicted 717
7 SASI_Hs01_00199973 predicted 693
8 SASI_Hs01_00199975 predicted 1166
9 SASI_Hs02_00350980 predicted 2990
10 SASI_Hs02_00350981 predicted 663
11 SASI_Hs01_00199967 predicted 914
12 SASI_Hs01_00199974 predicted 910
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058775 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00290858 predicted 1311
2 SASI_Rn02_00290859 predicted 1370
3 SASI_Rn02_00290860 predicted 1700
4 SASI_Rn02_00290861 predicted 1047
5 SASI_Rn02_00290862 predicted 1467
6 SASI_Rn02_00290863 predicted 1457
7 SASI_Rn02_00290864 predicted 1726
8 SASI_Rn02_00290865 predicted 980
9 SASI_Rn02_00290866 predicted 1054
10 SASI_Rn02_00290867 predicted 1169
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063553 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00307550 predicted 1374
2 SASI_Rn02_00307551 predicted 873
3 SASI_Rn02_00307552 predicted 275
4 SASI_Rn02_00307553 predicted 1045
5 SASI_Rn02_00307554 predicted 1464
6 SASI_Rn02_00307555 predicted 1456
7 SASI_Rn02_00307556 predicted 685
8 SASI_Rn02_00307557 predicted 3004
9 SASI_Rn02_00307558 predicted 1051
10 SASI_Rn02_00307559 predicted 1835
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029945 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037414 predicted 568
2 SASI_Mm01_00037415 predicted 365
3 SASI_Mm01_00037416 predicted 975
4 SASI_Mm01_00037417 predicted 208
5 SASI_Mm01_00037418 predicted 1748
6 SASI_Mm01_00037419 predicted 627
7 SASI_Mm01_00037420 predicted 310
8 SASI_Mm01_00037421 predicted 2553
9 SASI_Mm01_00037422 predicted 834
10 SASI_Mm02_00336242 predicted 221
11 SASI_Mm01_00037413 predicted 411
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029945
VALIDATED
SMPD4 MISSION shRNA Bacterial Glycerol Stock
sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029945.2-170s21c1
Sequence:CCGGGCCTGAAAGCTGACTCTATAACTCGAGTTATAGAGTCAGCTTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302442    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029945.2-2698s21c1
Sequence:CCGGGCAGTGGTGGAGTTATTCAAACTCGAGTTTGAATAACTCCACCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029945.2-1743s21c1
Sequence:CCGGCCCAATGTTTGGTCCTGAAATCTCGAGATTTCAGGACCAAACATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029945.2-634s21c1
Sequence:CCGGCCAATGTCTATGACCCTCCATCTCGAGATGGAGGGTCATAGACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124164    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029945.1-2699s1c1
Sequence:CCGGGCAGTGGTGGAGTTATTCAAACTCGAGTTTGAATAACTCCACCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029945.1-635s1c1
Sequence:CCGGCCAATGTCTATGACCCTCCATCTCGAGATGGAGGGTCATAGACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029945.1-577s1c1
Sequence:CCGGCCTCAATCCATTTGAATACTACTCGAGTAGTATTCAAATGGATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029945.1-1744s1c1
Sequence:CCGGCCCAATGTTTGGTCCTGAAATCTCGAGATTTCAGGACCAAACATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029945.1-171s1c1
Sequence:CCGGGCCTGAAAGCTGACTCTATAACTCGAGTTATAGAGTCAGCTTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029945
VALIDATED
SMPD4 MISSION shRNA shRNA Plasmid DNA
sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029945.2-170s21c1
Sequence:CCGGGCCTGAAAGCTGACTCTATAACTCGAGTTATAGAGTCAGCTTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302442    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029945.2-2698s21c1
Sequence:CCGGGCAGTGGTGGAGTTATTCAAACTCGAGTTTGAATAACTCCACCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029945.2-1743s21c1
Sequence:CCGGCCCAATGTTTGGTCCTGAAATCTCGAGATTTCAGGACCAAACATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029945.2-634s21c1
Sequence:CCGGCCAATGTCTATGACCCTCCATCTCGAGATGGAGGGTCATAGACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124164    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029945.1-2699s1c1
Sequence:CCGGGCAGTGGTGGAGTTATTCAAACTCGAGTTTGAATAACTCCACCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029945.1-635s1c1
Sequence:CCGGCCAATGTCTATGACCCTCCATCTCGAGATGGAGGGTCATAGACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029945.1-577s1c1
Sequence:CCGGCCTCAATCCATTTGAATACTACTCGAGTAGTATTCAAATGGATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029945.1-1744s1c1
Sequence:CCGGCCCAATGTTTGGTCCTGAAATCTCGAGATTTCAGGACCAAACATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029945.1-171s1c1
Sequence:CCGGGCCTGAAAGCTGACTCTATAACTCGAGTTATAGAGTCAGCTTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029945
VALIDATED
SMPD4 MISSION shRNA Lentiviral Transduction Particles
sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029945.2-170s21c1
Sequence:CCGGGCCTGAAAGCTGACTCTATAACTCGAGTTATAGAGTCAGCTTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302442    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029945.2-2698s21c1
Sequence:CCGGGCAGTGGTGGAGTTATTCAAACTCGAGTTTGAATAACTCCACCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029945.2-1743s21c1
Sequence:CCGGCCCAATGTTTGGTCCTGAAATCTCGAGATTTCAGGACCAAACATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029945.2-634s21c1
Sequence:CCGGCCAATGTCTATGACCCTCCATCTCGAGATGGAGGGTCATAGACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124164    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029945.1-2699s1c1
Sequence:CCGGGCAGTGGTGGAGTTATTCAAACTCGAGTTTGAATAACTCCACCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029945.1-635s1c1
Sequence:CCGGCCAATGTCTATGACCCTCCATCTCGAGATGGAGGGTCATAGACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029945.1-577s1c1
Sequence:CCGGCCTCAATCCATTTGAATACTACTCGAGTAGTATTCAAATGGATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029945.1-1744s1c1
Sequence:CCGGCCCAATGTTTGGTCCTGAAATCTCGAGATTTCAGGACCAAACATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029945.1-171s1c1
Sequence:CCGGGCCTGAAAGCTGACTCTATAACTCGAGTTATAGAGTCAGCTTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017751
VALIDATED
SMPD4 MISSION shRNA Bacterial Glycerol Stock
sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017751.2-682s21c1
Sequence:CCGGCCTGAAAGCTGACTCTATAAACTCGAGTTTATAGAGTCAGCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017751.2-1172s21c1
Sequence:CCGGACTTCAGACTGTGCCTATTTCCTCGAGGAAATAGGCACAGTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017751.2-2419s21c1
Sequence:CCGGGGAGTACCTGCGCCAGATATTCTCGAGAATATCTGGCGCAGGTACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017751.2-1086s21c1
Sequence:CCGGCCCTGAATCCGTTCGAGTATTCTCGAGAATACTCGAACGGATTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017751.2-720s21c1
Sequence:CCGGAGTGCCAAGACTTGGTTAAAGCTCGAGCTTTAACCAAGTCTTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017751.1-191s1c1
Sequence:CCGGGCAGTGCCAAGACTTGGTTAACTCGAGTTAACCAAGTCTTGGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017751
VALIDATED
SMPD4 MISSION shRNA shRNA Plasmid DNA
sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017751.2-682s21c1
Sequence:CCGGCCTGAAAGCTGACTCTATAAACTCGAGTTTATAGAGTCAGCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017751.2-1172s21c1
Sequence:CCGGACTTCAGACTGTGCCTATTTCCTCGAGGAAATAGGCACAGTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017751.2-2419s21c1
Sequence:CCGGGGAGTACCTGCGCCAGATATTCTCGAGAATATCTGGCGCAGGTACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017751.2-1086s21c1
Sequence:CCGGCCCTGAATCCGTTCGAGTATTCTCGAGAATACTCGAACGGATTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017751.2-720s21c1
Sequence:CCGGAGTGCCAAGACTTGGTTAAAGCTCGAGCTTTAACCAAGTCTTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017751.1-191s1c1
Sequence:CCGGGCAGTGCCAAGACTTGGTTAACTCGAGTTAACCAAGTCTTGGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017751
VALIDATED
SMPD4 MISSION shRNA Lentiviral Transduction Particles
sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017751.2-682s21c1
Sequence:CCGGCCTGAAAGCTGACTCTATAAACTCGAGTTTATAGAGTCAGCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017751.2-1172s21c1
Sequence:CCGGACTTCAGACTGTGCCTATTTCCTCGAGGAAATAGGCACAGTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017751.2-2419s21c1
Sequence:CCGGGGAGTACCTGCGCCAGATATTCTCGAGAATATCTGGCGCAGGTACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017751.2-1086s21c1
Sequence:CCGGCCCTGAATCCGTTCGAGTATTCTCGAGAATACTCGAACGGATTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017751.2-720s21c1
Sequence:CCGGAGTGCCAAGACTTGGTTAAAGCTCGAGCTTTAACCAAGTCTTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017751.1-191s1c1
Sequence:CCGGGCAGTGCCAAGACTTGGTTAACTCGAGTTAACCAAGTCTTGGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks