EMAIL THIS PAGE TO A FRIEND

SMR3A

submaxillary gland androgen regulated protein 3A

Synonyms: P-B1 PBI PRL5 PROL5
UniProtKB ID: Q99954
Gene ID:
Mouse(20599) submaxillary gland androgen regulated protein 3A
Rat(498341) submaxillary gland androgen regulated protein 3A
dog(608868) submaxillary gland androgen regulated protein 3A
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011423 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011423 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011423 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012390 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012390 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012390 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012390 Rosetta Predictions human pricing
NM_001017497 Rosetta Predictions rat pricing
NM_011422 Rosetta Predictions mouse pricing
NM_011423 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012390 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110271 predicted 332
2 SASI_Hs01_00110272 predicted 328
3 SASI_Hs01_00110273 predicted 367
4 SASI_Hs01_00110274 predicted 362
5 SASI_Hs01_00110276 predicted 340
6 SASI_Hs01_00110270 predicted 344
7 SASI_Hs01_00110275 predicted 277
8 SASI_Hs01_00110277 predicted 339
9 SASI_Hs02_00344197 predicted 522
10 SASI_Hs01_00110278 predicted 332
11 SASI_Hs01_00110279 predicted 246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017497 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066167 predicted 570
2 SASI_Rn01_00066168 predicted 104
3 SASI_Rn01_00066169 predicted 600
4 SASI_Rn01_00066170 predicted 492
5 SASI_Rn01_00066171 predicted 533
6 SASI_Rn02_00202318 predicted 139
7 SASI_Rn01_00066172 predicted 450
8 SASI_Rn01_00066173 predicted 486
9 SASI_Rn01_00066175 predicted 509
10 SASI_Rn02_00202319 predicted 607
11 SASI_Rn01_00066174 predicted 559
12 SASI_Rn01_00066176 predicted 352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011422 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102995 predicted 220
2 SASI_Mm01_00102996 predicted 286
3 SASI_Mm01_00102997 predicted 411
4 SASI_Mm01_00102998 predicted 436
5 SASI_Mm01_00102999 predicted 252
6 SASI_Mm01_00103000 predicted 249
7 SASI_Mm01_00103001 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011423 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140527 predicted 234
2 SASI_Mm01_00140528 predicted 230
3 SASI_Mm01_00140529 predicted 219
4 SASI_Mm01_00140530 predicted 248
5 SASI_Mm01_00140531 predicted 213
6 SASI_Mm01_00140532 predicted 226
7 SASI_Mm01_00140533 predicted 245
8 SASI_Mm01_00140534 predicted 227
9 SASI_Mm01_00140535 predicted 208
10 SASI_Mm01_00140536 predicted 324
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011423
SMR3A MISSION shRNA Bacterial Glycerol Stock
submaxillary gland androgen regulated protein 3A
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000181371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011423.1-282s1c1
Sequence:CCGGCCTACTGCTAGAGATTCCACTCTCGAGAGTGGAATCTCTAGCAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011423.1-232s1c1
Sequence:CCGGCCACAGTACAAGCAACTACAACTCGAGTTGTAGTTGCTTGTACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011423.1-271s1c1
Sequence:CCGGCCATAACTACTCCTACTGCTACTCGAGTAGCAGTAGGAGTAGTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011423.1-265s1c1
Sequence:CCGGGTATCTCCATAACTACTCCTACTCGAGTAGGAGTAGTTATGGAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011423
SMR3A MISSION shRNA shRNA Plasmid DNA
submaxillary gland androgen regulated protein 3A
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000181371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011423.1-282s1c1
Sequence:CCGGCCTACTGCTAGAGATTCCACTCTCGAGAGTGGAATCTCTAGCAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011423.1-232s1c1
Sequence:CCGGCCACAGTACAAGCAACTACAACTCGAGTTGTAGTTGCTTGTACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011423.1-271s1c1
Sequence:CCGGCCATAACTACTCCTACTGCTACTCGAGTAGCAGTAGGAGTAGTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011423.1-265s1c1
Sequence:CCGGGTATCTCCATAACTACTCCTACTCGAGTAGGAGTAGTTATGGAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011423
SMR3A MISSION shRNA Lentiviral Transduction Particles
submaxillary gland androgen regulated protein 3A
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000181371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011423.1-282s1c1
Sequence:CCGGCCTACTGCTAGAGATTCCACTCTCGAGAGTGGAATCTCTAGCAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011423.1-232s1c1
Sequence:CCGGCCACAGTACAAGCAACTACAACTCGAGTTGTAGTTGCTTGTACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011423.1-271s1c1
Sequence:CCGGCCATAACTACTCCTACTGCTACTCGAGTAGCAGTAGGAGTAGTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011423.1-265s1c1
Sequence:CCGGGTATCTCCATAACTACTCCTACTCGAGTAGGAGTAGTTATGGAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012390
SMR3A MISSION shRNA Bacterial Glycerol Stock
submaxillary gland androgen regulated protein 3A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012390.3-415s21c1
Sequence:CCGGTATCCACCTGGACCTCCATTTCTCGAGAAATGGAGGTCCAGGTGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012390.3-355s21c1
Sequence:CCGGCACTCTCTTCCTCCTCCTTATCTCGAGATAAGGAGGAGGAAGAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012390.3-250s21c1
Sequence:CCGGCCCTATGGTCCAGGGAGATTTCTCGAGAAATCTCCCTGGACCATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012390.3-280s21c1
Sequence:CCGGCTTTCTCCACCCTATGGTCCACTCGAGTGGACCATAGGGTGGAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012390.3-132s21c1
Sequence:CCGGCACACCTGGTGAGAGTCAAAGCTCGAGCTTTGACTCTCACCAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012390
SMR3A MISSION shRNA shRNA Plasmid DNA
submaxillary gland androgen regulated protein 3A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012390.3-415s21c1
Sequence:CCGGTATCCACCTGGACCTCCATTTCTCGAGAAATGGAGGTCCAGGTGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012390.3-355s21c1
Sequence:CCGGCACTCTCTTCCTCCTCCTTATCTCGAGATAAGGAGGAGGAAGAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012390.3-250s21c1
Sequence:CCGGCCCTATGGTCCAGGGAGATTTCTCGAGAAATCTCCCTGGACCATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012390.3-280s21c1
Sequence:CCGGCTTTCTCCACCCTATGGTCCACTCGAGTGGACCATAGGGTGGAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012390.3-132s21c1
Sequence:CCGGCACACCTGGTGAGAGTCAAAGCTCGAGCTTTGACTCTCACCAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012390
SMR3A MISSION shRNA Lentiviral Transduction Particles
submaxillary gland androgen regulated protein 3A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012390.3-415s21c1
Sequence:CCGGTATCCACCTGGACCTCCATTTCTCGAGAAATGGAGGTCCAGGTGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012390.3-355s21c1
Sequence:CCGGCACTCTCTTCCTCCTCCTTATCTCGAGATAAGGAGGAGGAAGAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012390.3-250s21c1
Sequence:CCGGCCCTATGGTCCAGGGAGATTTCTCGAGAAATCTCCCTGGACCATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012390.3-280s21c1
Sequence:CCGGCTTTCTCCACCCTATGGTCCACTCGAGTGGACCATAGGGTGGAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012390.3-132s21c1
Sequence:CCGGCACACCTGGTGAGAGTCAAAGCTCGAGCTTTGACTCTCACCAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks