EMAIL THIS PAGE TO A FRIEND

SMTNL1

smoothelin-like 1

Synonyms: CHASM
UniProtKB ID: A8MU46
Gene ID:
Human(219537) Summary: SMTNL1, which is a member of the smoothelin (SMTN; MIM 602127) family, regulates contraction and relaxation of skeletal and smooth muscle fibers and mediates vascular adaptation to exercise (Wooldridge et al., 2008 [PubMed 18310078]
Mouse(68678) smoothelin-like 1
Rat(311167) smoothelin-like 1
Zebrafish(503743) smoothelin-like 1
chicken(101668603) smoothelin-like 1
chicken(101750657) smoothelin-like 1
dog(483492) smoothelin-like 1
domestic cat(101090291) smoothelin-like 1
naked mole-rat(101708309) smoothelin-like 1
domestic guinea pig(100712621) smoothelin-like 1
cow(614015) smoothelin-like 1
sheep(101120950) smoothelin-like 1
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024230 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024230 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024230 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001105565 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001105565 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001105565 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU231601 MISSION® esiRNA esiRNA targeting human SMTNL1 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105565 Rosetta Predictions human pricing
XM_166203 Rosetta Predictions human pricing
XM_001069604 Rosetta Predictions rat pricing
XM_230278 Rosetta Predictions rat pricing
NM_024230 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105565 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324451 predicted 1305
2 SASI_Hs02_00324452 predicted 521
3 SASI_Hs02_00324453 predicted 1175
4 SASI_Hs02_00324454 predicted 694
5 SASI_Hs02_00324455 predicted 1452
6 SASI_Hs02_00324456 predicted 1086
7 SASI_Hs02_00324457 predicted 1139
8 SASI_Hs02_00324458 predicted 495
9 SASI_Hs02_00324459 predicted 593
10 SASI_Hs02_00324460 predicted 401
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_166203 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00283148 predicted 1330
2 SASI_Hs01_00283149 predicted 545
3 SASI_Hs01_00283150 predicted 1194
4 SASI_Hs01_00283151 predicted 720
5 SASI_Hs01_00283152 predicted 639
6 SASI_Hs01_00283153 predicted 1501
7 SASI_Hs01_00283154 predicted 1473
8 SASI_Hs01_00283155 predicted 624
9 SASI_Hs01_00283156 predicted 523
10 SASI_Hs01_00283157 predicted 610
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069604 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00328652 predicted 521
2 SASI_Rn02_00328653 predicted 347
3 SASI_Rn02_00328654 predicted 429
4 SASI_Rn02_00328655 predicted 362
5 SASI_Rn02_00328656 predicted 780
6 SASI_Rn02_00328657 predicted 839
7 SASI_Rn02_00328658 predicted 474
8 SASI_Rn02_00328659 predicted 1019
9 SASI_Rn02_00328660 predicted 960
10 SASI_Rn02_00328661 predicted 782
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230278 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00144874 predicted 470
2 SASI_Rn01_00144876 predicted 450
3 SASI_Rn01_00144877 predicted 217
4 SASI_Rn01_00144878 predicted 344
5 SASI_Rn02_00386132 predicted 428
6 SASI_Rn02_00386133 predicted 356
7 SASI_Rn01_00144879 predicted 468
8 SASI_Rn01_00144881 predicted 454
9 SASI_Rn01_00144882 predicted 447
10 SASI_Rn01_00144883 predicted 227
11 SASI_Rn01_00144875 predicted 336
12 SASI_Rn01_00144880 predicted 392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024230 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069064 predicted 285
2 SASI_Mm01_00069065 predicted 941
3 SASI_Mm01_00069066 predicted 234
4 SASI_Mm01_00069067 predicted 968
5 SASI_Mm01_00069068 predicted 300
6 SASI_Mm01_00069070 predicted 1473
7 SASI_Mm01_00069071 predicted 366
8 SASI_Mm01_00069072 predicted 621
9 SASI_Mm01_00069073 predicted 1533
10 SASI_Mm02_00327601 predicted 1227
11 SASI_Mm01_00069069 predicted 535
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024230
SMTNL1 MISSION shRNA Bacterial Glycerol Stock
smoothelin-like 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112940    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024230.1-1624s1c1
Sequence:CCGGAGCAGGTGACACCAGTATCAACTCGAGTTGATACTGGTGTCACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024230.1-332s1c1
Sequence:CCGGCAGCATCTAAGAGTGGCGAATCTCGAGATTCGCCACTCTTAGATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024230.1-529s1c1
Sequence:CCGGCCCAATGAAGTTAGGGAGAAACTCGAGTTTCTCCCTAACTTCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024230.1-1365s1c1
Sequence:CCGGGCACAACTTCACCCTAGCTTTCTCGAGAAAGCTAGGGTGAAGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024230.1-1104s1c1
Sequence:CCGGGAAGGCCATCATGGACAAATTCTCGAGAATTTGTCCATGATGGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024230.2-1150s21c1
Sequence:CCGGGCACTGTTCCGGAACACAAAGCTCGAGCTTTGTGTTCCGGAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024230.2-1241s21c1
Sequence:CCGGACGAGCACGTGGATATCCAAACTCGAGTTTGGATATCCACGTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024230.2-595s21c1
Sequence:CCGGGAGACCAATCTAGAATCTAAGCTCGAGCTTAGATTCTAGATTGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024230.2-1477s21c1
Sequence:CCGGACCTACATCCAGGAGCTATACCTCGAGGTATAGCTCCTGGATGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024230.2-304s21c1
Sequence:CCGGTCAGATTGGGCAGAACATTTGCTCGAGCAAATGTTCTGCCCAATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024230
SMTNL1 MISSION shRNA shRNA Plasmid DNA
smoothelin-like 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112940    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024230.1-1624s1c1
Sequence:CCGGAGCAGGTGACACCAGTATCAACTCGAGTTGATACTGGTGTCACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024230.1-332s1c1
Sequence:CCGGCAGCATCTAAGAGTGGCGAATCTCGAGATTCGCCACTCTTAGATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024230.1-529s1c1
Sequence:CCGGCCCAATGAAGTTAGGGAGAAACTCGAGTTTCTCCCTAACTTCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024230.1-1365s1c1
Sequence:CCGGGCACAACTTCACCCTAGCTTTCTCGAGAAAGCTAGGGTGAAGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024230.1-1104s1c1
Sequence:CCGGGAAGGCCATCATGGACAAATTCTCGAGAATTTGTCCATGATGGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024230.2-1150s21c1
Sequence:CCGGGCACTGTTCCGGAACACAAAGCTCGAGCTTTGTGTTCCGGAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024230.2-1241s21c1
Sequence:CCGGACGAGCACGTGGATATCCAAACTCGAGTTTGGATATCCACGTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024230.2-595s21c1
Sequence:CCGGGAGACCAATCTAGAATCTAAGCTCGAGCTTAGATTCTAGATTGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024230.2-1477s21c1
Sequence:CCGGACCTACATCCAGGAGCTATACCTCGAGGTATAGCTCCTGGATGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024230.2-304s21c1
Sequence:CCGGTCAGATTGGGCAGAACATTTGCTCGAGCAAATGTTCTGCCCAATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024230
SMTNL1 MISSION shRNA Lentiviral Transduction Particles
smoothelin-like 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112940    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024230.1-1624s1c1
Sequence:CCGGAGCAGGTGACACCAGTATCAACTCGAGTTGATACTGGTGTCACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024230.1-332s1c1
Sequence:CCGGCAGCATCTAAGAGTGGCGAATCTCGAGATTCGCCACTCTTAGATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024230.1-529s1c1
Sequence:CCGGCCCAATGAAGTTAGGGAGAAACTCGAGTTTCTCCCTAACTTCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024230.1-1365s1c1
Sequence:CCGGGCACAACTTCACCCTAGCTTTCTCGAGAAAGCTAGGGTGAAGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024230.1-1104s1c1
Sequence:CCGGGAAGGCCATCATGGACAAATTCTCGAGAATTTGTCCATGATGGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024230.2-1150s21c1
Sequence:CCGGGCACTGTTCCGGAACACAAAGCTCGAGCTTTGTGTTCCGGAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024230.2-1241s21c1
Sequence:CCGGACGAGCACGTGGATATCCAAACTCGAGTTTGGATATCCACGTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024230.2-595s21c1
Sequence:CCGGGAGACCAATCTAGAATCTAAGCTCGAGCTTAGATTCTAGATTGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024230.2-1477s21c1
Sequence:CCGGACCTACATCCAGGAGCTATACCTCGAGGTATAGCTCCTGGATGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024230.2-304s21c1
Sequence:CCGGTCAGATTGGGCAGAACATTTGCTCGAGCAAATGTTCTGCCCAATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001105565
SMTNL1 MISSION shRNA Bacterial Glycerol Stock
smoothelin-like 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105565.1-477s21c1
Sequence:CCGGGAAAGAGGCCAAACCTGAATCCTCGAGGATTCAGGTTTGGCCTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105565.1-266s21c1
Sequence:CCGGATGGATTAGATGAGGTCAAAGCTCGAGCTTTGACCTCATCTAATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105565.1-318s21c1
Sequence:CCGGGGATGCTGAGGCTGAACTTAACTCGAGTTAAGTTCAGCCTCAGCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105565.1-1743s21c1
Sequence:CCGGTCTGCACTCTGGGATAATAAACTCGAGTTTATTATCCCAGAGTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105565.1-1147s21c1
Sequence:CCGGGCCTTGTTCCGCAACACTAAGCTCGAGCTTAGTGTTGCGGAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001105565
SMTNL1 MISSION shRNA shRNA Plasmid DNA
smoothelin-like 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105565.1-477s21c1
Sequence:CCGGGAAAGAGGCCAAACCTGAATCCTCGAGGATTCAGGTTTGGCCTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105565.1-266s21c1
Sequence:CCGGATGGATTAGATGAGGTCAAAGCTCGAGCTTTGACCTCATCTAATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105565.1-318s21c1
Sequence:CCGGGGATGCTGAGGCTGAACTTAACTCGAGTTAAGTTCAGCCTCAGCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105565.1-1743s21c1
Sequence:CCGGTCTGCACTCTGGGATAATAAACTCGAGTTTATTATCCCAGAGTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105565.1-1147s21c1
Sequence:CCGGGCCTTGTTCCGCAACACTAAGCTCGAGCTTAGTGTTGCGGAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001105565
SMTNL1 MISSION shRNA Lentiviral Transduction Particles
smoothelin-like 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105565.1-477s21c1
Sequence:CCGGGAAAGAGGCCAAACCTGAATCCTCGAGGATTCAGGTTTGGCCTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105565.1-266s21c1
Sequence:CCGGATGGATTAGATGAGGTCAAAGCTCGAGCTTTGACCTCATCTAATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105565.1-318s21c1
Sequence:CCGGGGATGCTGAGGCTGAACTTAACTCGAGTTAAGTTCAGCCTCAGCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105565.1-1743s21c1
Sequence:CCGGTCTGCACTCTGGGATAATAAACTCGAGTTTATTATCCCAGAGTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105565.1-1147s21c1
Sequence:CCGGGCCTTGTTCCGCAACACTAAGCTCGAGCTTAGTGTTGCGGAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks