EMAIL THIS PAGE TO A FRIEND

SMURF2

SMAD specific E3 ubiquitin protein ligase 2

UniProtKB ID: Q9HAU4, Q52LL1, Q9H260
Gene ID:
Mouse(66313) SMAD specific E3 ubiquitin protein ligase 2
Rat(303614) SMAD specific E3 ubiquitin protein ligase 2
Zebrafish(563633) SMAD specific E3 ubiquitin protein ligase 2
Horse(100064082) SMAD specific E3 ubiquitin protein ligase 2
domestic cat(101085162) SMAD specific E3 ubiquitin protein ligase 2
dog(480470) SMAD specific E3 ubiquitin protein ligase 2
chicken(427809) SMAD specific E3 ubiquitin protein ligase 2
naked mole-rat(101697984) SMAD specific E3 ubiquitin protein ligase 2
Domestic Rabbit(100358121) SMAD specific E3 ubiquitin protein ligase 2
domestic guinea pig(100734512) SMAD specific E3 ubiquitin protein ligase 2
cow(540826) SMAD specific E3 ubiquitin protein ligase 2
sheep(101106698) SMAD specific E3 ubiquitin protein ligase 2
106 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_126673 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_126673 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_126673 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022739 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022739 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022739 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025481 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025481 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025481 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022739 Rosetta Predictions human pricing
NM_001107061 Rosetta Predictions rat pricing
NM_025481 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022739 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013161 predicted 1831
2 SASI_Hs01_00013162 predicted 1778
3 SASI_Hs01_00013163 predicted 891
4 SASI_Hs01_00013164 predicted 1596
5 SASI_Hs01_00013165 predicted 770
6 SASI_Hs01_00013166 predicted 2498
7 SASI_Hs01_00013167 predicted 1981
8 SASI_Hs01_00013168 predicted 1564
9 SASI_Hs01_00013169 predicted 1663
10 SASI_Hs01_00013170 predicted 1297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107061 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225106 predicted 1860
2 SASI_Rn02_00225107 predicted 461
3 SASI_Rn02_00225108 predicted 1547
4 SASI_Rn02_00225109 predicted 665
5 SASI_Rn02_00225110 predicted 1499
6 SASI_Rn02_00225111 predicted 1425
7 SASI_Rn02_00225112 predicted 1761
8 SASI_Rn02_00225113 predicted 486
9 SASI_Rn02_00225114 predicted 2206
10 SASI_Rn02_00225115 predicted 1750
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025481 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328351 predicted 1408
2 SASI_Mm01_00065019 predicted 491
3 SASI_Mm01_00065020 predicted 671
4 SASI_Mm01_00065021 predicted 1608
5 SASI_Mm01_00065022 predicted 1379
6 SASI_Mm01_00065023 predicted 1814
7 SASI_Mm01_00065025 predicted 1341
8 SASI_Mm01_00065026 predicted 2262
9 SASI_Mm01_00065027 predicted 1849
10 SASI_Mm02_00328352 predicted 1220
11 SASI_Mm01_00065018 predicted 1348
12 SASI_Mm01_00065024 predicted 522
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_126673
VALIDATED
SMURF2 MISSION shRNA Bacterial Glycerol Stock
SMAD specific E3 ubiquitin protein ligase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_126673.4-1539s1c1
Sequence:CCGGGCCAAGATACAAGCGAGATTTCTCGAGAAATCTCGCTTGTATCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126673.4-829s1c1
Sequence:CCGGCGAGGACAAATTGTAGGTAATCTCGAGATTACCTACAATTTGTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_126673.4-2023s1c1
Sequence:CCGGCCAGACCTTCATAATAGTTTACTCGAGTAAACTATTATGAAGGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_126673.4-1368s1c1
Sequence:CCGGCGCAACAGGAAGAGTTTATTTCTCGAGAAATAAACTCTTCCTGTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_126673.4-2583s1c1
Sequence:CCGGCCACACTTGCTTCAATCGAATCTCGAGATTCGATTGAAGCAAGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_126673
VALIDATED
SMURF2 MISSION shRNA shRNA Plasmid DNA
SMAD specific E3 ubiquitin protein ligase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_126673.4-1539s1c1
Sequence:CCGGGCCAAGATACAAGCGAGATTTCTCGAGAAATCTCGCTTGTATCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126673.4-829s1c1
Sequence:CCGGCGAGGACAAATTGTAGGTAATCTCGAGATTACCTACAATTTGTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_126673.4-2023s1c1
Sequence:CCGGCCAGACCTTCATAATAGTTTACTCGAGTAAACTATTATGAAGGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_126673.4-1368s1c1
Sequence:CCGGCGCAACAGGAAGAGTTTATTTCTCGAGAAATAAACTCTTCCTGTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_126673.4-2583s1c1
Sequence:CCGGCCACACTTGCTTCAATCGAATCTCGAGATTCGATTGAAGCAAGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_126673
VALIDATED
SMURF2 MISSION shRNA Lentiviral Transduction Particles
SMAD specific E3 ubiquitin protein ligase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_126673.4-1539s1c1
Sequence:CCGGGCCAAGATACAAGCGAGATTTCTCGAGAAATCTCGCTTGTATCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126673.4-829s1c1
Sequence:CCGGCGAGGACAAATTGTAGGTAATCTCGAGATTACCTACAATTTGTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_126673.4-2023s1c1
Sequence:CCGGCCAGACCTTCATAATAGTTTACTCGAGTAAACTATTATGAAGGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_126673.4-1368s1c1
Sequence:CCGGCGCAACAGGAAGAGTTTATTTCTCGAGAAATAAACTCTTCCTGTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_126673.4-2583s1c1
Sequence:CCGGCCACACTTGCTTCAATCGAATCTCGAGATTCGATTGAAGCAAGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022739
VALIDATED
SMURF2 MISSION shRNA Bacterial Glycerol Stock
SMAD specific E3 ubiquitin protein ligase 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022739.x-459s1c1
Sequence:CCGGGCTGGATTTCTCGGTTGTGTTCTCGAGAACACAACCGAGAAATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003475    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022739.x-2829s1c1
Sequence:CCGGCGGTACAAGTCACATTTCATTCTCGAGAATGAAATGTGACTTGTACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022739.x-1788s1c1
Sequence:CCGGGTGTGGATACTTGAGAATGATCTCGAGATCATTCTCAAGTATCCACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022739.x-504s1c1
Sequence:CCGGCGCCTCAAAGACACTGGTTATCTCGAGATAACCAGTGTCTTTGAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022739.x-2355s1c1
Sequence:CCGGCCACCCTATGAAAGCTATGAACTCGAGTTCATAGCTTTCATAGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022739.3-833s21c1
Sequence:CCGGGTGGACTGCAGTCGTTTATTTCTCGAGAAATAAACGACTGCAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022739.3-659s21c1
Sequence:CCGGGCTGGATTTCTCGGTTGTGTTCTCGAGAACACAACCGAGAAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272879    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022739.3-2648s21c1
Sequence:CCGGATTTACCCAGGACTCTATTTACTCGAGTAAATAGAGTCCTGGGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022739.3-1636s21c1
Sequence:CCGGAGATCTCTGGAAGCGATTAATCTCGAGATTAATCGCTTCCAGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022739.3-954s21c1
Sequence:CCGGCACGACCGGCATCCGAATATTCTCGAGAATATTCGGATGCCGGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022739
VALIDATED
SMURF2 MISSION shRNA shRNA Plasmid DNA
SMAD specific E3 ubiquitin protein ligase 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022739.x-459s1c1
Sequence:CCGGGCTGGATTTCTCGGTTGTGTTCTCGAGAACACAACCGAGAAATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003475    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022739.x-2829s1c1
Sequence:CCGGCGGTACAAGTCACATTTCATTCTCGAGAATGAAATGTGACTTGTACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022739.x-1788s1c1
Sequence:CCGGGTGTGGATACTTGAGAATGATCTCGAGATCATTCTCAAGTATCCACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022739.x-504s1c1
Sequence:CCGGCGCCTCAAAGACACTGGTTATCTCGAGATAACCAGTGTCTTTGAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022739.x-2355s1c1
Sequence:CCGGCCACCCTATGAAAGCTATGAACTCGAGTTCATAGCTTTCATAGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022739.3-833s21c1
Sequence:CCGGGTGGACTGCAGTCGTTTATTTCTCGAGAAATAAACGACTGCAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022739.3-659s21c1
Sequence:CCGGGCTGGATTTCTCGGTTGTGTTCTCGAGAACACAACCGAGAAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272879    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022739.3-2648s21c1
Sequence:CCGGATTTACCCAGGACTCTATTTACTCGAGTAAATAGAGTCCTGGGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022739.3-1636s21c1
Sequence:CCGGAGATCTCTGGAAGCGATTAATCTCGAGATTAATCGCTTCCAGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022739.3-954s21c1
Sequence:CCGGCACGACCGGCATCCGAATATTCTCGAGAATATTCGGATGCCGGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022739
VALIDATED
SMURF2 MISSION shRNA Lentiviral Transduction Particles
SMAD specific E3 ubiquitin protein ligase 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022739.x-459s1c1
Sequence:CCGGGCTGGATTTCTCGGTTGTGTTCTCGAGAACACAACCGAGAAATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003475    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022739.x-2829s1c1
Sequence:CCGGCGGTACAAGTCACATTTCATTCTCGAGAATGAAATGTGACTTGTACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022739.x-1788s1c1
Sequence:CCGGGTGTGGATACTTGAGAATGATCTCGAGATCATTCTCAAGTATCCACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022739.x-504s1c1
Sequence:CCGGCGCCTCAAAGACACTGGTTATCTCGAGATAACCAGTGTCTTTGAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022739.x-2355s1c1
Sequence:CCGGCCACCCTATGAAAGCTATGAACTCGAGTTCATAGCTTTCATAGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022739.3-833s21c1
Sequence:CCGGGTGGACTGCAGTCGTTTATTTCTCGAGAAATAAACGACTGCAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022739.3-659s21c1
Sequence:CCGGGCTGGATTTCTCGGTTGTGTTCTCGAGAACACAACCGAGAAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272879    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022739.3-2648s21c1
Sequence:CCGGATTTACCCAGGACTCTATTTACTCGAGTAAATAGAGTCCTGGGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022739.3-1636s21c1
Sequence:CCGGAGATCTCTGGAAGCGATTAATCTCGAGATTAATCGCTTCCAGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022739.3-954s21c1
Sequence:CCGGCACGACCGGCATCCGAATATTCTCGAGAATATTCGGATGCCGGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025481
SMURF2 MISSION shRNA Bacterial Glycerol Stock
SMAD specific E3 ubiquitin protein ligase 2
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000426727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025481.2-572s21c1
Sequence:CCGGTCCGTCTTCCTGATCCATTTGCTCGAGCAAATGGATCAGGAAGACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025481.2-1329s21c1
Sequence:CCGGACGAGTGCCTAGGGATCTTAGCTCGAGCTAAGATCCCTAGGCACTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025481
SMURF2 MISSION shRNA shRNA Plasmid DNA
SMAD specific E3 ubiquitin protein ligase 2
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000426727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025481.2-572s21c1
Sequence:CCGGTCCGTCTTCCTGATCCATTTGCTCGAGCAAATGGATCAGGAAGACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025481.2-1329s21c1
Sequence:CCGGACGAGTGCCTAGGGATCTTAGCTCGAGCTAAGATCCCTAGGCACTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025481
SMURF2 MISSION shRNA Lentiviral Transduction Particles
SMAD specific E3 ubiquitin protein ligase 2
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000426727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025481.2-572s21c1
Sequence:CCGGTCCGTCTTCCTGATCCATTTGCTCGAGCAAATGGATCAGGAAGACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025481.2-1329s21c1
Sequence:CCGGACGAGTGCCTAGGGATCTTAGCTCGAGCTAAGATCCCTAGGCACTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks