EMAIL THIS PAGE TO A FRIEND

SNAP23

synaptosomal-associated protein, 23kDa

Synonyms: HsT17016 SNAP-23 SNAP23A SNAP23B
UniProtKB ID: O00161, O00162, Q13602, Q6IAE3
Gene ID:
Human(8773) Summary: Specificity of vesicular transport is regulated, in part, by the interaction of a vesicle-associated membrane protein termed synaptobrevin/VAMP with a target compartment membrane protein termed syntaxin. These proteins, together with SNAP25 (synaptosome-associated protein of 25 kDa), form a complex which serves as a binding site for the general membrane fusion machinery. Synaptobrevin/VAMP and syntaxin are believed to be involved in vesicular transport in most, if not all cells, while SNAP25 is present almost exclusively in the brain, suggesting that a ubiquitously expressed homolog of SNAP25 exists to facilitate transport vesicle/target membrane fusion in other tissues. The protein encoded by this gene is structurally and functionally similar to SNAP25 and binds tightly to multiple syntaxins and synaptobrevins/VAMPs. It is an essential component of the high affinity receptor for the general membrane fusion machinery and is an important regulator of transport vesicle docking and fusion. Two alternative transcript variants encoding different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(20619) synaptosomal-associated protein 23
Rat(64630) synaptosomal-associated protein 23
chicken(423235) synaptosomal-associated protein, 23kDa
domestic cat(101101473) synaptosomal-associated protein, 23kDa
dog(478268) synaptosomal-associated protein, 23kDa
naked mole-rat(101711373) synaptosomal-associated protein, 23kDa
Domestic Rabbit(100008776) synaptosomal-associated protein, 23kDa
domestic guinea pig(100722747) synaptosomal-associated protein, 23kDa
cow(522423) synaptosomal-associated protein, 23kDa
sheep(101117588) synaptosomal-associated protein, 23kDa
132 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003825 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003825 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003825 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009222 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009222 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009222 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003825 Rosetta Predictions human pricing
NM_130798 Rosetta Predictions human pricing
NM_022689 Rosetta Predictions rat pricing
NM_009222 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003825 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172213 predicted 823
2 SASI_Hs01_00172214 predicted 755
3 SASI_Hs02_00336374 predicted 809
4 SASI_Hs02_00336375 predicted 761
5 SASI_Hs02_00336376 predicted 810
6 SASI_Hs01_00172215 predicted 734
7 SASI_Hs01_00172216 predicted 165
8 SASI_Hs01_00172217 predicted 603
9 SASI_Hs01_00172218 predicted 361
10 SASI_Hs01_00172219 predicted 664
11 SASI_Hs01_00172220 predicted 199
12 SASI_Hs01_00172221 predicted 299
13 SASI_Hs01_00172222 predicted 606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130798 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224583 predicted 662
2 SASI_Hs01_00224584 predicted 595
3 SASI_Hs02_00362830 predicted 650
4 SASI_Hs02_00362831 predicted 596
5 SASI_Hs02_00362832 predicted 651
6 SASI_Hs01_00224585 predicted 576
7 SASI_Hs01_00224586 predicted 172
8 SASI_Hs01_00224587 predicted 445
9 SASI_Hs01_00224588 predicted 505
10 SASI_Hs01_00224590 predicted 197
11 SASI_Hs01_00224589 predicted 253
12 SASI_Hs01_00224591 predicted 296
13 SASI_Hs01_00224592 predicted 441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022689 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263476 predicted 206
2 SASI_Rn02_00263477 predicted 223
3 SASI_Rn01_00079444 predicted 550
4 SASI_Rn02_00263478 predicted 255
5 SASI_Rn02_00263479 predicted 735
6 SASI_Rn01_00079446 predicted 349
7 SASI_Rn02_00263480 predicted 237
8 SASI_Rn02_00263481 predicted 261
9 SASI_Rn01_00079449 predicted 496
10 SASI_Rn02_00263482 predicted 564
11 SASI_Rn01_00079445 predicted 353
12 SASI_Rn01_00079447 predicted 323
13 SASI_Rn01_00079448 predicted 267
14 SASI_Rn01_00079450 predicted 336
15 SASI_Rn01_00079451 predicted 216
16 SASI_Rn01_00079452 predicted 333
17 SASI_Rn01_00079453 predicted 410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009222 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176530 predicted 759
2 SASI_Mm01_00176531 predicted 293
3 SASI_Mm01_00176532 predicted 750
4 SASI_Mm01_00176533 predicted 252
5 SASI_Mm01_00176534 predicted 777
6 SASI_Mm01_00176535 predicted 852
7 SASI_Mm01_00176536 predicted 285
8 SASI_Mm01_00176537 predicted 685
9 SASI_Mm01_00176538 predicted 808
10 SASI_Mm01_00176539 predicted 262
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003825
VALIDATED
SNAP23 MISSION shRNA Bacterial Glycerol Stock
synaptosomal-associated protein, 23kDa
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003825.2-420s1c1
Sequence:CCGGCACCTTGCAATGTAGTATCTACTCGAGTAGATACTACATTGCAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003825.2-612s1c1
Sequence:CCGGGCAATGAGATTGATGCTCAAACTCGAGTTTGAGCATCAATCTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003825.2-378s1c1
Sequence:CCGGGCAAGGCTTATAAGACAACATCTCGAGATGTTGTCTTATAAGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003825.2-239s1c1
Sequence:CCGGGAACAACTAAACCGCATAGAACTCGAGTTCTATGCGGTTTAGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144931    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003825.2-819s1c1
Sequence:CCGGGCTCTTCTAATTGGGAGATAACTCGAGTTATCTCCCAATTAGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003825.2-602s1c1
Sequence:CCGGCTGAACATAGGCAATGAGATTCTCGAGAATCTCATTGCCTATGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139864    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003825.2-1048s1c1
Sequence:CCGGGCCATGAAGAAGGAAGCTGTACTCGAGTACAGCTTCCTTCTTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003825.2-601s1c1
Sequence:CCGGCCTGAACATAGGCAATGAGATCTCGAGATCTCATTGCCTATGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003825.2-129s1c1
Sequence:CCGGCTCACCAGATTACTGATGAGTCTCGAGACTCATCAGTAATCTGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141483    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003825.2-990s1c1
Sequence:CCGGCCTCATATACTTCAGCAGGTTCTCGAGAACCTGCTGAAGTATATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003825.2-698s1c1
Sequence:CCGGGCCAGAGCAAAGAAACTCATTCTCGAGAATGAGTTTCTTTGCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003825.2-515s1c1
Sequence:CCGGCGCATAACTAATGATGCCAGACTCGAGTCTGGCATCATTAGTTATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143926    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003825.2-1701s1c1
Sequence:CCGGCCCATTTCTTATTGCACCATTCTCGAGAATGGTGCAATAAGAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003825.2-501s21c1
Sequence:GTACCGGGTGGATACATTAAACGCATAACTCGAGTTATGCGTTTAATGTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003825.2-709s21c1
Sequence:GTACCGGGAAACTCATTGACAGCTAAAGCTCGAGCTTTAGCTGTCAATGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003825.2-571s21c1
Sequence:GTACCGGCAGTATCCTGGGAAATCTAAACTCGAGTTTAGATTTCCCAGGATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003825.2-371s21c1
Sequence:CCGGGAGTCTGGCAAGGCTTATAAGCTCGAGCTTATAAGCCTTGCCAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257197    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003825.2-1222s21c1
Sequence:CCGGTTGCAGTTATAGCCAATTTAGCTCGAGCTAAATTGGCTATAACTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003825
VALIDATED
SNAP23 MISSION shRNA shRNA Plasmid DNA
synaptosomal-associated protein, 23kDa
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003825.2-420s1c1
Sequence:CCGGCACCTTGCAATGTAGTATCTACTCGAGTAGATACTACATTGCAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003825.2-612s1c1
Sequence:CCGGGCAATGAGATTGATGCTCAAACTCGAGTTTGAGCATCAATCTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003825.2-378s1c1
Sequence:CCGGGCAAGGCTTATAAGACAACATCTCGAGATGTTGTCTTATAAGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003825.2-239s1c1
Sequence:CCGGGAACAACTAAACCGCATAGAACTCGAGTTCTATGCGGTTTAGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144931    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003825.2-819s1c1
Sequence:CCGGGCTCTTCTAATTGGGAGATAACTCGAGTTATCTCCCAATTAGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003825.2-602s1c1
Sequence:CCGGCTGAACATAGGCAATGAGATTCTCGAGAATCTCATTGCCTATGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139864    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003825.2-1048s1c1
Sequence:CCGGGCCATGAAGAAGGAAGCTGTACTCGAGTACAGCTTCCTTCTTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003825.2-601s1c1
Sequence:CCGGCCTGAACATAGGCAATGAGATCTCGAGATCTCATTGCCTATGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003825.2-129s1c1
Sequence:CCGGCTCACCAGATTACTGATGAGTCTCGAGACTCATCAGTAATCTGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141483    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003825.2-990s1c1
Sequence:CCGGCCTCATATACTTCAGCAGGTTCTCGAGAACCTGCTGAAGTATATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003825.2-698s1c1
Sequence:CCGGGCCAGAGCAAAGAAACTCATTCTCGAGAATGAGTTTCTTTGCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003825.2-515s1c1
Sequence:CCGGCGCATAACTAATGATGCCAGACTCGAGTCTGGCATCATTAGTTATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143926    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003825.2-1701s1c1
Sequence:CCGGCCCATTTCTTATTGCACCATTCTCGAGAATGGTGCAATAAGAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003825.2-501s21c1
Sequence:GTACCGGGTGGATACATTAAACGCATAACTCGAGTTATGCGTTTAATGTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003825.2-709s21c1
Sequence:GTACCGGGAAACTCATTGACAGCTAAAGCTCGAGCTTTAGCTGTCAATGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003825.2-571s21c1
Sequence:GTACCGGCAGTATCCTGGGAAATCTAAACTCGAGTTTAGATTTCCCAGGATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003825.2-371s21c1
Sequence:CCGGGAGTCTGGCAAGGCTTATAAGCTCGAGCTTATAAGCCTTGCCAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257197    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003825.2-1222s21c1
Sequence:CCGGTTGCAGTTATAGCCAATTTAGCTCGAGCTAAATTGGCTATAACTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003825
VALIDATED
SNAP23 MISSION shRNA Lentiviral Transduction Particles
synaptosomal-associated protein, 23kDa
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003825.2-420s1c1
Sequence:CCGGCACCTTGCAATGTAGTATCTACTCGAGTAGATACTACATTGCAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003825.2-612s1c1
Sequence:CCGGGCAATGAGATTGATGCTCAAACTCGAGTTTGAGCATCAATCTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003825.2-378s1c1
Sequence:CCGGGCAAGGCTTATAAGACAACATCTCGAGATGTTGTCTTATAAGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003825.2-239s1c1
Sequence:CCGGGAACAACTAAACCGCATAGAACTCGAGTTCTATGCGGTTTAGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144931    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003825.2-819s1c1
Sequence:CCGGGCTCTTCTAATTGGGAGATAACTCGAGTTATCTCCCAATTAGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003825.2-602s1c1
Sequence:CCGGCTGAACATAGGCAATGAGATTCTCGAGAATCTCATTGCCTATGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139864    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003825.2-1048s1c1
Sequence:CCGGGCCATGAAGAAGGAAGCTGTACTCGAGTACAGCTTCCTTCTTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003825.2-601s1c1
Sequence:CCGGCCTGAACATAGGCAATGAGATCTCGAGATCTCATTGCCTATGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003825.2-129s1c1
Sequence:CCGGCTCACCAGATTACTGATGAGTCTCGAGACTCATCAGTAATCTGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141483    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003825.2-990s1c1
Sequence:CCGGCCTCATATACTTCAGCAGGTTCTCGAGAACCTGCTGAAGTATATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003825.2-698s1c1
Sequence:CCGGGCCAGAGCAAAGAAACTCATTCTCGAGAATGAGTTTCTTTGCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003825.2-515s1c1
Sequence:CCGGCGCATAACTAATGATGCCAGACTCGAGTCTGGCATCATTAGTTATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143926    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003825.2-1701s1c1
Sequence:CCGGCCCATTTCTTATTGCACCATTCTCGAGAATGGTGCAATAAGAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003825.2-501s21c1
Sequence:GTACCGGGTGGATACATTAAACGCATAACTCGAGTTATGCGTTTAATGTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003825.2-709s21c1
Sequence:GTACCGGGAAACTCATTGACAGCTAAAGCTCGAGCTTTAGCTGTCAATGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003825.2-571s21c1
Sequence:GTACCGGCAGTATCCTGGGAAATCTAAACTCGAGTTTAGATTTCCCAGGATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003825.2-371s21c1
Sequence:CCGGGAGTCTGGCAAGGCTTATAAGCTCGAGCTTATAAGCCTTGCCAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257197    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003825.2-1222s21c1
Sequence:CCGGTTGCAGTTATAGCCAATTTAGCTCGAGCTAAATTGGCTATAACTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009222
VALIDATED
SNAP23 MISSION shRNA Bacterial Glycerol Stock
synaptosomal-associated protein, 23kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009222.2-775s1c1
Sequence:CCGGGCCAATACAAGAGCAAAGAAACTCGAGTTTCTTTGCTCTTGTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009222.2-325s1c1
Sequence:CCGGGAACAACTAAATCGCATAGAACTCGAGTTCTATGCGATTTAGTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110575    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009222.2-1014s1c1
Sequence:CCGGCGTCTCTTCATCTCTTCATTTCTCGAGAAATGAAGAGATGAAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009222.2-432s1c1
Sequence:CCGGCCCTTGTAATAGGACAAAGAACTCGAGTTCTTTGTCCTATTACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009222.2-507s1c1
Sequence:CCGGACCTAGCAATGTAGTATCTAACTCGAGTTAGATACTACATTGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009222.3-774s21c1
Sequence:CCGGGCCAATACAAGAGCAAAGAAACTCGAGTTTCTTTGCTCTTGTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009222.3-528s21c1
Sequence:CCGGCAACCGAGCCGGATTACAAATCTCGAGATTTGTAATCCGGCTCGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009222.3-583s21c1
Sequence:CCGGGTGGATACATTAAACGTATAACTCGAGTTATACGTTTAATGTATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009222.3-324s21c1
Sequence:CCGGGAACAACTAAATCGCATAGAACTCGAGTTCTATGCGATTTAGTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325517    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009222.3-1013s21c1
Sequence:CCGGCGTCTCTTCATCTCTTCATTTCTCGAGAAATGAAGAGATGAAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009222
VALIDATED
SNAP23 MISSION shRNA shRNA Plasmid DNA
synaptosomal-associated protein, 23kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009222.2-775s1c1
Sequence:CCGGGCCAATACAAGAGCAAAGAAACTCGAGTTTCTTTGCTCTTGTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009222.2-325s1c1
Sequence:CCGGGAACAACTAAATCGCATAGAACTCGAGTTCTATGCGATTTAGTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110575    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009222.2-1014s1c1
Sequence:CCGGCGTCTCTTCATCTCTTCATTTCTCGAGAAATGAAGAGATGAAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009222.2-432s1c1
Sequence:CCGGCCCTTGTAATAGGACAAAGAACTCGAGTTCTTTGTCCTATTACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009222.2-507s1c1
Sequence:CCGGACCTAGCAATGTAGTATCTAACTCGAGTTAGATACTACATTGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009222.3-774s21c1
Sequence:CCGGGCCAATACAAGAGCAAAGAAACTCGAGTTTCTTTGCTCTTGTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009222.3-528s21c1
Sequence:CCGGCAACCGAGCCGGATTACAAATCTCGAGATTTGTAATCCGGCTCGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009222.3-583s21c1
Sequence:CCGGGTGGATACATTAAACGTATAACTCGAGTTATACGTTTAATGTATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009222.3-324s21c1
Sequence:CCGGGAACAACTAAATCGCATAGAACTCGAGTTCTATGCGATTTAGTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325517    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009222.3-1013s21c1
Sequence:CCGGCGTCTCTTCATCTCTTCATTTCTCGAGAAATGAAGAGATGAAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009222
VALIDATED
SNAP23 MISSION shRNA Lentiviral Transduction Particles
synaptosomal-associated protein, 23kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009222.2-775s1c1
Sequence:CCGGGCCAATACAAGAGCAAAGAAACTCGAGTTTCTTTGCTCTTGTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009222.2-325s1c1
Sequence:CCGGGAACAACTAAATCGCATAGAACTCGAGTTCTATGCGATTTAGTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110575    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009222.2-1014s1c1
Sequence:CCGGCGTCTCTTCATCTCTTCATTTCTCGAGAAATGAAGAGATGAAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009222.2-432s1c1
Sequence:CCGGCCCTTGTAATAGGACAAAGAACTCGAGTTCTTTGTCCTATTACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009222.2-507s1c1
Sequence:CCGGACCTAGCAATGTAGTATCTAACTCGAGTTAGATACTACATTGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009222.3-774s21c1
Sequence:CCGGGCCAATACAAGAGCAAAGAAACTCGAGTTTCTTTGCTCTTGTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009222.3-528s21c1
Sequence:CCGGCAACCGAGCCGGATTACAAATCTCGAGATTTGTAATCCGGCTCGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009222.3-583s21c1
Sequence:CCGGGTGGATACATTAAACGTATAACTCGAGTTATACGTTTAATGTATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009222.3-324s21c1
Sequence:CCGGGAACAACTAAATCGCATAGAACTCGAGTTCTATGCGATTTAGTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325517    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009222.3-1013s21c1
Sequence:CCGGCGTCTCTTCATCTCTTCATTTCTCGAGAAATGAAGAGATGAAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks