EMAIL THIS PAGE TO A FRIEND

SNAPC1

small nuclear RNA activating complex, polypeptide 1, 43kDa

Synonyms: PTFgamma SNAP43
UniProtKB ID: Q16533
Gene ID:
Mouse(75627) small nuclear RNA activating complex, polypeptide 1
Rat(314228) small nuclear RNA activating complex, polypeptide 1
cow(615539) small nuclear RNA activating complex, polypeptide 1, 43kDa
sheep(101106332) small nuclear RNA activating complex, polypeptide 1, 43kDa
domestic guinea pig(100713388) small nuclear RNA activating complex, polypeptide 1, 43kDa
naked mole-rat(101716427) small nuclear RNA activating complex, polypeptide 1, 43kDa
chicken(423517) small nuclear RNA activating complex, polypeptide 1, 43kDa
domestic cat(101094354) small nuclear RNA activating complex, polypeptide 1, 43kDa
dog(611346) small nuclear RNA activating complex, polypeptide 1, 43kDa
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003082 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003082 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003082 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178392 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178392 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178392 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003082 Rosetta Predictions human pricing
NM_001108033 Rosetta Predictions rat pricing
XM_234299 Rosetta Predictions rat pricing
NM_178392 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003082 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136270 predicted 1005
2 SASI_Hs01_00136271 predicted 233
3 SASI_Hs01_00136272 predicted 544
4 SASI_Hs01_00136273 predicted 430
5 SASI_Hs02_00335009 predicted 543
6 SASI_Hs01_00136274 predicted 391
7 SASI_Hs01_00136275 predicted 394
8 SASI_Hs01_00136277 predicted 1002
9 SASI_Hs01_00136279 predicted 509
10 SASI_Hs02_00335010 predicted 826
11 SASI_Hs01_00136276 predicted 320
12 SASI_Hs01_00136278 predicted 261
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108033 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234705 predicted 1032
2 SASI_Rn02_00234706 predicted 563
3 SASI_Rn02_00234707 predicted 596
4 SASI_Rn02_00234708 predicted 1081
5 SASI_Rn02_00234709 predicted 243
6 SASI_Rn02_00234710 predicted 673
7 SASI_Rn02_00234711 predicted 943
8 SASI_Rn02_00234712 predicted 749
9 SASI_Rn02_00234713 predicted 277
10 SASI_Rn02_00234714 predicted 1248
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234299 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00142727 predicted 666
2 SASI_Rn01_00142728 predicted 247
3 SASI_Rn01_00142729 predicted 655
4 SASI_Rn01_00142730 predicted 689
5 SASI_Rn01_00142731 predicted 343
6 SASI_Rn01_00142732 predicted 597
7 SASI_Rn01_00142733 predicted 347
8 SASI_Rn01_00142734 predicted 533
9 SASI_Rn01_00142735 predicted 759
10 SASI_Rn01_00142736 predicted 992
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178392 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115305 predicted 541
2 SASI_Mm01_00115306 predicted 304
3 SASI_Mm01_00115307 predicted 1056
4 SASI_Mm01_00115308 predicted 581
5 SASI_Mm01_00115309 predicted 623
6 SASI_Mm01_00115311 predicted 670
7 SASI_Mm01_00115312 predicted 1082
8 SASI_Mm01_00115313 predicted 238
9 SASI_Mm01_00115314 predicted 399
10 SASI_Mm02_00348801 predicted 582
11 SASI_Mm01_00115310 predicted 1266
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003082
VALIDATED
SNAPC1 MISSION shRNA Bacterial Glycerol Stock
small nuclear RNA activating complex, polypeptide 1, 43kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284714    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003082.3-1605s21c1
Sequence:CCGGTTGTATCTACAGTCGGATAATCTCGAGATTATCCGACTGTAGATACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003082.3-776s21c1
Sequence:CCGGGCAGTGGCACAAAGACAGAAACTCGAGTTTCTGTCTTTGTGCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003082.3-280s21c1
Sequence:CCGGTAGCTTTGGCTTGGCGATATTCTCGAGAATATCGCCAAGCCAAAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003082.3-341s21c1
Sequence:CCGGGTATCTGCTATATGGATTATACTCGAGTATAATCCATATAGCAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003082.3-593s21c1
Sequence:CCGGCCCAAGTGATCGTGTGATGAACTCGAGTTCATCACACGATCACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003082.2-441s1c1
Sequence:CCGGGCTGTCATATAGGATGAAGAACTCGAGTTCTTCATCCTATATGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003082.2-684s1c1
Sequence:CCGGGCAGTGGCACAAAGACAGAAACTCGAGTTTCTGTCTTTGTGCCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003082.2-826s1c1
Sequence:CCGGGTTGTCATACAGGCATCCAAACTCGAGTTTGGATGCCTGTATGACAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003082.2-501s1c1
Sequence:CCGGCCCAAGTGATCGTGTGATGAACTCGAGTTCATCACACGATCACTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003082.2-1027s1c1
Sequence:CCGGAGTCTGAGTATGCCTGTAATTCTCGAGAATTACAGGCATACTCAGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003082
VALIDATED
SNAPC1 MISSION shRNA shRNA Plasmid DNA
small nuclear RNA activating complex, polypeptide 1, 43kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284714    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003082.3-1605s21c1
Sequence:CCGGTTGTATCTACAGTCGGATAATCTCGAGATTATCCGACTGTAGATACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003082.3-776s21c1
Sequence:CCGGGCAGTGGCACAAAGACAGAAACTCGAGTTTCTGTCTTTGTGCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003082.3-280s21c1
Sequence:CCGGTAGCTTTGGCTTGGCGATATTCTCGAGAATATCGCCAAGCCAAAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003082.3-341s21c1
Sequence:CCGGGTATCTGCTATATGGATTATACTCGAGTATAATCCATATAGCAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003082.3-593s21c1
Sequence:CCGGCCCAAGTGATCGTGTGATGAACTCGAGTTCATCACACGATCACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003082.2-441s1c1
Sequence:CCGGGCTGTCATATAGGATGAAGAACTCGAGTTCTTCATCCTATATGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003082.2-684s1c1
Sequence:CCGGGCAGTGGCACAAAGACAGAAACTCGAGTTTCTGTCTTTGTGCCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003082.2-826s1c1
Sequence:CCGGGTTGTCATACAGGCATCCAAACTCGAGTTTGGATGCCTGTATGACAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003082.2-501s1c1
Sequence:CCGGCCCAAGTGATCGTGTGATGAACTCGAGTTCATCACACGATCACTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003082.2-1027s1c1
Sequence:CCGGAGTCTGAGTATGCCTGTAATTCTCGAGAATTACAGGCATACTCAGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003082
VALIDATED
SNAPC1 MISSION shRNA Lentiviral Transduction Particles
small nuclear RNA activating complex, polypeptide 1, 43kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284714    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003082.3-1605s21c1
Sequence:CCGGTTGTATCTACAGTCGGATAATCTCGAGATTATCCGACTGTAGATACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003082.3-776s21c1
Sequence:CCGGGCAGTGGCACAAAGACAGAAACTCGAGTTTCTGTCTTTGTGCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003082.3-280s21c1
Sequence:CCGGTAGCTTTGGCTTGGCGATATTCTCGAGAATATCGCCAAGCCAAAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003082.3-341s21c1
Sequence:CCGGGTATCTGCTATATGGATTATACTCGAGTATAATCCATATAGCAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003082.3-593s21c1
Sequence:CCGGCCCAAGTGATCGTGTGATGAACTCGAGTTCATCACACGATCACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003082.2-441s1c1
Sequence:CCGGGCTGTCATATAGGATGAAGAACTCGAGTTCTTCATCCTATATGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003082.2-684s1c1
Sequence:CCGGGCAGTGGCACAAAGACAGAAACTCGAGTTTCTGTCTTTGTGCCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003082.2-826s1c1
Sequence:CCGGGTTGTCATACAGGCATCCAAACTCGAGTTTGGATGCCTGTATGACAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003082.2-501s1c1
Sequence:CCGGCCCAAGTGATCGTGTGATGAACTCGAGTTCATCACACGATCACTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003082.2-1027s1c1
Sequence:CCGGAGTCTGAGTATGCCTGTAATTCTCGAGAATTACAGGCATACTCAGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178392
VALIDATED
SNAPC1 MISSION shRNA Bacterial Glycerol Stock
small nuclear RNA activating complex, polypeptide 1, 43kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099645    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178392.2-1486s1c1
Sequence:CCGGGCCTTCAGAATGTAATAGAAACTCGAGTTTCTATTACATTCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178392.2-561s1c1
Sequence:CCGGCCGAATGATCGTGTAATGAAACTCGAGTTTCATTACACGATCATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178392.2-611s1c1
Sequence:CCGGGCTGAATGTTCACGATCATTACTCGAGTAATGATCGTGAACATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178392.2-560s1c1
Sequence:CCGGCCCGAATGATCGTGTAATGAACTCGAGTTCATTACACGATCATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178392.2-1053s1c1
Sequence:CCGGGCTCCGAATGAACGTAAGGAACTCGAGTTCCTTACGTTCATTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178392
VALIDATED
SNAPC1 MISSION shRNA shRNA Plasmid DNA
small nuclear RNA activating complex, polypeptide 1, 43kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099645    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178392.2-1486s1c1
Sequence:CCGGGCCTTCAGAATGTAATAGAAACTCGAGTTTCTATTACATTCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178392.2-561s1c1
Sequence:CCGGCCGAATGATCGTGTAATGAAACTCGAGTTTCATTACACGATCATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178392.2-611s1c1
Sequence:CCGGGCTGAATGTTCACGATCATTACTCGAGTAATGATCGTGAACATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178392.2-560s1c1
Sequence:CCGGCCCGAATGATCGTGTAATGAACTCGAGTTCATTACACGATCATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178392.2-1053s1c1
Sequence:CCGGGCTCCGAATGAACGTAAGGAACTCGAGTTCCTTACGTTCATTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178392
VALIDATED
SNAPC1 MISSION shRNA Lentiviral Transduction Particles
small nuclear RNA activating complex, polypeptide 1, 43kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099645    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178392.2-1486s1c1
Sequence:CCGGGCCTTCAGAATGTAATAGAAACTCGAGTTTCTATTACATTCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178392.2-561s1c1
Sequence:CCGGCCGAATGATCGTGTAATGAAACTCGAGTTTCATTACACGATCATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178392.2-611s1c1
Sequence:CCGGGCTGAATGTTCACGATCATTACTCGAGTAATGATCGTGAACATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178392.2-560s1c1
Sequence:CCGGCCCGAATGATCGTGTAATGAACTCGAGTTCATTACACGATCATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178392.2-1053s1c1
Sequence:CCGGGCTCCGAATGAACGTAAGGAACTCGAGTTCCTTACGTTCATTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks