EMAIL THIS PAGE TO A FRIEND

SNCA

synuclein, alpha (non A4 component of amyloid precursor)

Synonyms: NACP PARK1 PARK4 PD1
UniProtKB ID: P37840, A8K2A4, Q13701, Q4JHI3, Q6IAU6
Gene ID:
Human(6622) Summary: Alpha-synuclein is a member of the synuclein family, which also includes beta- and gamma-synuclein. Synucleins are abundantly expressed in the brain and alpha- and beta-synuclein inhibit phospholipase D2 selectively. SNCA may serve to integrate presynaptic signaling and membrane trafficking. Defects in SNCA have been implicated in the pathogenesis of Parkinson disease. SNCA peptides are a major component of amyloid plaques in the brains of patients with Alzheimer's disease. Four alternatively spliced transcripts encoding two different isoforms have been identified for this gene. [provided by RefSeq, Mar 2009]
Mouse(20617) synuclein, alpha
Rat(29219) synuclein, alpha (non A4 component of amyloid precursor)
chicken(395393) synuclein, alpha (non A4 component of amyloid precursor)
Horse(100053270) synuclein, alpha (non A4 component of amyloid precursor)
domestic cat(101091694) synuclein, alpha (non A4 component of amyloid precursor)
dog(478478) synuclein, alpha (non A4 component of amyloid precursor)
cow(282857) synuclein, alpha (non A4 component of amyloid precursor)
sheep(100294604) synuclein, alpha (non A4 component of amyloid precursor)
domestic guinea pig(100725375) synuclein, alpha (non A4 component of amyloid precursor)
naked mole-rat(101700039) synuclein, alpha (non A4 component of amyloid precursor)
166 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1300799 Anti-α-Synuclein (N-term) antibody produced in rabbit saturated ammonium sulfate (SAS) precipitated, buffered aqueous solution human
ELISA, immunohistochemistry pricing
S3062 Anti-α-Synuclein antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution rat, human
immunohistochemistry, microarray, western blot pricing
S5566 Anti-α-Synuclein antibody, Mouse monoclonal clone Syn211, purified from hybridoma cell culture zebrafish, human
immunohistochemistry, immunoprecipitation, western blot pricing
SAB4300139 Anti-phospho-SNCA (pSer129) antibody produced in rabbit affinity isolated antibody mouse, rat, human
western blot pricing
SAB4300204 Anti-phospho-SNCA (pTyr125) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, western blot pricing
SAB4300226 Anti-phospho-SNCA (pTyr133) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunofluorescence, western blot pricing
SAB4300227 Anti-phospho-SNCA (pTyr136) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunofluorescence, western blot pricing
SAB4503996 Anti-phospho-Synuclein (pSer129) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4504551 Anti-phospho-Synuclein-α (pTyr133) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504552 Anti-phospho-Synuclein-α (pTyr136) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4300502 Anti-SNCA (Ab-125) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4300445 Anti-SNCA (Ab-129) antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
SAB4300528 Anti-SNCA (Ab-133) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunofluorescence, western blot pricing
SAB4300529 Anti-Snca (Ab-136) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunofluorescence, western blot pricing
SAB2502111 Anti-SNCA antibody produced in goat affinity isolated antibody, buffered aqueous solution human, mouse, canine, pig, rat
ELISA, western blot pricing
SAB2502112 Anti-SNCA antibody produced in goat affinity isolated antibody, buffered aqueous solution pig, human
ELISA, western blot pricing
SAB2108227 Anti-SNCA antibody produced in rabbit affinity isolated antibody bovine, rabbit, guinea pig, canine, rat, pig, horse, human, mouse
western blot pricing
SAB2102253 Anti-SNCA antibody produced in rabbit affinity isolated antibody, lyophilized powder canine, bovine, rabbit, human, mouse, rat, pig, horse
western blot pricing
HPA005459 Anti-SNCA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4502828 Anti-Synuclein, C-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing
SAB4502829 Anti-Synuclein-α, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4502830 Anti-Synuclein-α, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4502831 Anti-Synuclein-pan, N-Terminal antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry, western blot pricing
WH0006622M1 Monoclonal Anti-SNCA antibody produced in mouse clone 2E4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5300371 Monoclonal Anti-SNCA antibody produced in mouse clone 2B2D1, ascites fluid human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009221 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009221 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009221 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000345 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000345 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000345 MISSION® shRNA Lentiviral Transduction Particles human pricing

Related Products

Product # Description Species Add to Cart
 
MABN633 Anti-a-Synuclein, clone 10D2 Antibody 100 µg, Anti-a-Synuclein, clone 10D2 Antibody is an antibody against a-Synuclein for use in western blotting, IHC & ELISA. pricing
MABN389 Anti-Aggregated a-Synuclein Antibody, clone 5G4 100 µg, This Anti-Aggregated a-Synuclein Antibody, clone 5G4 is validated for use in western blotting, IHC & ELISA for the detection of Aggregated a-Synuclein. pricing
36-008-C Anti-alpha-Synuclein (aa 121-125) Antibody, clone Syn211 (Ascites Free) 100 µg, Anti-alpha-Synuclein (aa 121-125) Antibody, clone Syn211 (Ascites Free) is an antibody against alpha-Synuclein for use in Immunohistochemistry and Western Blotting. pricing
MABN1805 Anti-alpha-Synuclein Antibody, clone 9C4 50 μg, Anti-alpha-Synuclein, clone 9C4, Cat. No. MABN1805, is a highly specific mouse monoclonal antibody, that targets alpha synuclein and has been tested in Immunohistochemistry (Paraffin) and Western Blotting. pricing
MABN1839 Anti-Amyloid-β (oligomer) Antibody, clone F11G3 100 μg, This Anti-Amyloid-β (oligomer) Antibody, clone F11G3 is validated for use in Western Blotting, Dot Blot, ELISA, Immunofluorescence, Immunoprecipitation for the detection of Amyloid-β. pricing
36-011 Anti-nitro-α/β-Synuclein Antibody, clone nSyn12 200 µL, Anti-nitro-α/β-Synuclein Antibody, clone nSyn12 is an antibody against nitro-α/β-Synuclein for use in WB, IH. pricing
36-012 Anti-nitro-α/β-Synuclein (Tyr39) Antibody, clone nSyn14 200 µL, Anti-nitro-α/β-Synuclein (Tyr39) Antibody, clone nSyn14 detects level of nitro-α/β-Synuclein (Tyr39) & has been published & validated for use in WB, IH. pricing
ABE155 Anti-phospho Histone H3.1/H3.2 Antibody (Ser87) 100 µg, Detect Histone H3 using this rabbit polyclonal antibody, Anti-phospho Histone H3.1/H3.2 Antibody (Ser87) validated for use in western blotting & Dot Blot. pricing
AB9850 Anti-phospho-α Synuclein (Ser129) Antibody 100 µL, This Anti-phospho-α Synuclein (Ser129) Antibody is validated for use in WB for the detection of phospho-α Synuclein (Ser129). pricing
MABN826 Anti-phospho-α-Synuclein (Ser129) Antibody, clone 81A 100 μg, Detect phospho-α-Synuclein using this Anti-phospho-α-Synuclein (Ser129) Antibody, clone 81A validated for use in Electron Microscopy, Immunocytochemistry, Immunofluorescence, Immunohistochemistry (Paraffin), Western Blotting. pricing
AB5038 Anti-Synuclein α Antibody 50 µL, Anti-Synuclein Antibody, α detects level of Synuclein & has been published & validated for use in IC, IH, IH(P) & WB. pricing
AB5038P Anti-Synuclein α Antibody 20 µg, This Anti-Synuclein Antibody, α is validated for use in IH(P), WB for the detection of Synuclein. pricing
AB5334P Anti-Synuclein α Antibody 50 µg, Detect Synuclein using this Anti-Synuclein Antibody, α validated for use in WB, IH(P). pricing
AB5336P Anti-Synuclein α Antibody 50 µg, Anti-Synuclein Antibody, α is an antibody against Synuclein for use in IH(P). pricing
MABN1817 Anti-α-Synuclein Antibody, clone 2F12 100 µL, Anti-α-Synuclein, clone 2F12, Cat. No. MABN1817, is a highly specific mouse monoclonal antibody that targets α-synuclein and has been tested in ELISA, Immunocytochemistry, Immunohistochemistry (Paraffin), Immunoprecipitation, and Western Blotting. pricing
MAB5320 Anti-Synuclein α Antibody, clone 7B12.2 100 µL, Anti-Synuclein Antibody, α, clone 7B12.2 detects level of Synuclein & has been published & validated for use in IH & WB. pricing
MABN1818 Anti-α-Synuclein Antibody, clone SOY1 200 µL, Anti-α-Synuclein, clone SOY1 Antibody, Cat. No. MABN1818, is a highly specific mouse monoclonal antibody that targets -synuclein and has been tested in ELISA, Immunohistochemistry (Paraffin), Immunoprecipitation, and Western Blotting. pricing
36-008 Anti-α-Synuclein Antibody, clone Syn211 200 µL, Detect α-Synuclein using this Anti-α-Synuclein Antibody, clone Syn211 validated for use in IP, WB, IH. pricing
AB5464 Anti-Synuclein Antibody, pan 50 µL, Detect Synuclein using this Anti-Synuclein Antibody, pan validated for use in WB, IH(P). pricing
AG548 α-synuclein 1-95, human 500 µg pricing
AG549 α-synuclein 61-140, human 500 µg pricing
AG240 Synuclein α, control peptide for AB5334P 100 µg pricing
AG938 Synuclein, α, recombinant human 500 µg pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000345 Rosetta Predictions human pricing
NM_007308 Rosetta Predictions human pricing
NM_019169 Rosetta Predictions rat pricing
NM_001042451 Rosetta Predictions mouse pricing
NM_009221 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000345 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032299 predicted 744
2 SASI_Hs01_00032300 predicted 703
3 SASI_Hs01_00032302 predicted 923
4 SASI_Hs01_00032303 predicted 806
5 SASI_Hs01_00032304 predicted 739
6 SASI_Hs02_00302377 predicted 735
7 SASI_Hs01_00032306 predicted 919
8 SASI_Hs01_00032307 predicted 795
9 SASI_Hs01_00032308 predicted 732
10 SASI_Hs02_00302378 predicted 856
11 SASI_Hs01_00032301 predicted 813
12 SASI_Hs01_00032305 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007308 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020351 predicted 627
2 SASI_Hs01_00020352 predicted 582
3 SASI_Hs01_00020354 predicted 799
4 SASI_Hs01_00020355 predicted 690
5 SASI_Hs01_00020356 predicted 624
6 SASI_Hs02_00343375 predicted 614
7 SASI_Hs01_00020358 predicted 802
8 SASI_Hs01_00020359 predicted 683
9 SASI_Hs01_00020360 predicted 621
10 SASI_Hs02_00343376 predicted 738
11 SASI_Hs01_00020353 predicted 686
12 SASI_Hs01_00020357 predicted 799
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019169 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110108 predicted 585
2 SASI_Rn01_00110109 predicted 584
3 SASI_Rn01_00110110 predicted 854
4 SASI_Rn01_00110111 predicted 486
5 SASI_Rn01_00110112 predicted 563
6 SASI_Rn01_00110113 predicted 266
7 SASI_Rn02_00261957 predicted 863
8 SASI_Rn01_00110114 predicted 862
9 SASI_Rn01_00110115 predicted 644
10 SASI_Rn01_00110116 predicted 469
11 SASI_Rn01_00110117 predicted 684
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042451 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290385 predicted 990
2 SASI_Mm02_00290386 predicted 705
3 SASI_Mm02_00290387 predicted 949
4 SASI_Mm02_00290388 predicted 928
5 SASI_Mm02_00290389 predicted 777
6 SASI_Mm02_00290390 predicted 849
7 SASI_Mm02_00290391 predicted 760
8 SASI_Mm02_00290392 predicted 728
9 SASI_Mm02_00290393 predicted 955
10 SASI_Mm02_00290394 predicted 995
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009221 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315656 predicted 897
2 SASI_Mm02_00315657 predicted 620
3 SASI_Mm02_00315658 predicted 866
4 SASI_Mm02_00315659 predicted 842
5 SASI_Mm02_00315660 predicted 692
6 SASI_Mm02_00315661 predicted 764
7 SASI_Mm02_00315662 predicted 669
8 SASI_Mm02_00315663 predicted 636
9 SASI_Mm02_00315664 predicted 524
10 SASI_Mm02_00315665 predicted 864
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009221
VALIDATED
SNCA MISSION shRNA Bacterial Glycerol Stock
synuclein, alpha (non A4 component of amyloid precursor)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009221.2-625s21c1
Sequence:CCGGTGAAGCCTAAGAATGTCATTGCTCGAGCAATGACATTCTTAGGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009221.2-566s21c1
Sequence:CCGGGATCCTGGCAGTGAGGCTTATCTCGAGATAAGCCTCACTGCCAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009221.2-456s21c1
Sequence:CCGGTGGAGGGAGCTGGGAATATAGCTCGAGCTATATTCCCAGCTCCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366590    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009221.2-910s21c1
Sequence:CCGGTGACTACCACTTATTTCTAAACTCGAGTTTAGAAATAAGTGGTAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009221.2-387s21c1
Sequence:CCGGCCAAAGAGCAAGTGACAAATGCTCGAGCATTTGTCACTTGCTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377011    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009221.2-860s21c1
Sequence:CCGGTTGTTGTGGCTTCACACTTAACTCGAGTTAAGTGTGAAGCCACAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106635    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009221.1-635s1c1
Sequence:CCGGGCAATGTCATTGGCACCCAATCTCGAGATTGGGTGCCAATGACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009221.1-351s1c1
Sequence:CCGGGAGTGGTTCATGGAGTGACAACTCGAGTTGTCACTCCATGAACCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009221.1-599s1c1
Sequence:CCGGGAGGAAGGCTACCAAGACTATCTCGAGATAGTCTTGGTAGCCTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009221.1-576s1c1
Sequence:CCGGGTGAGGCTTATGAAATGCCTTCTCGAGAAGGCATTTCATAAGCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009221.1-320s1c1
Sequence:CCGGGTCCTCTATGTAGGTTCCAAACTCGAGTTTGGAACCTACATAGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009221
VALIDATED
SNCA MISSION shRNA shRNA Plasmid DNA
synuclein, alpha (non A4 component of amyloid precursor)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009221.2-625s21c1
Sequence:CCGGTGAAGCCTAAGAATGTCATTGCTCGAGCAATGACATTCTTAGGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009221.2-566s21c1
Sequence:CCGGGATCCTGGCAGTGAGGCTTATCTCGAGATAAGCCTCACTGCCAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009221.2-456s21c1
Sequence:CCGGTGGAGGGAGCTGGGAATATAGCTCGAGCTATATTCCCAGCTCCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366590    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009221.2-910s21c1
Sequence:CCGGTGACTACCACTTATTTCTAAACTCGAGTTTAGAAATAAGTGGTAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009221.2-387s21c1
Sequence:CCGGCCAAAGAGCAAGTGACAAATGCTCGAGCATTTGTCACTTGCTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377011    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009221.2-860s21c1
Sequence:CCGGTTGTTGTGGCTTCACACTTAACTCGAGTTAAGTGTGAAGCCACAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106635    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009221.1-635s1c1
Sequence:CCGGGCAATGTCATTGGCACCCAATCTCGAGATTGGGTGCCAATGACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009221.1-351s1c1
Sequence:CCGGGAGTGGTTCATGGAGTGACAACTCGAGTTGTCACTCCATGAACCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009221.1-599s1c1
Sequence:CCGGGAGGAAGGCTACCAAGACTATCTCGAGATAGTCTTGGTAGCCTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009221.1-576s1c1
Sequence:CCGGGTGAGGCTTATGAAATGCCTTCTCGAGAAGGCATTTCATAAGCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009221.1-320s1c1
Sequence:CCGGGTCCTCTATGTAGGTTCCAAACTCGAGTTTGGAACCTACATAGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009221
VALIDATED
SNCA MISSION shRNA Lentiviral Transduction Particles
synuclein, alpha (non A4 component of amyloid precursor)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009221.2-625s21c1
Sequence:CCGGTGAAGCCTAAGAATGTCATTGCTCGAGCAATGACATTCTTAGGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009221.2-566s21c1
Sequence:CCGGGATCCTGGCAGTGAGGCTTATCTCGAGATAAGCCTCACTGCCAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009221.2-456s21c1
Sequence:CCGGTGGAGGGAGCTGGGAATATAGCTCGAGCTATATTCCCAGCTCCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366590    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009221.2-910s21c1
Sequence:CCGGTGACTACCACTTATTTCTAAACTCGAGTTTAGAAATAAGTGGTAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009221.2-387s21c1
Sequence:CCGGCCAAAGAGCAAGTGACAAATGCTCGAGCATTTGTCACTTGCTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377011    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009221.2-860s21c1
Sequence:CCGGTTGTTGTGGCTTCACACTTAACTCGAGTTAAGTGTGAAGCCACAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106635    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009221.1-635s1c1
Sequence:CCGGGCAATGTCATTGGCACCCAATCTCGAGATTGGGTGCCAATGACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009221.1-351s1c1
Sequence:CCGGGAGTGGTTCATGGAGTGACAACTCGAGTTGTCACTCCATGAACCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009221.1-599s1c1
Sequence:CCGGGAGGAAGGCTACCAAGACTATCTCGAGATAGTCTTGGTAGCCTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009221.1-576s1c1
Sequence:CCGGGTGAGGCTTATGAAATGCCTTCTCGAGAAGGCATTTCATAAGCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009221.1-320s1c1
Sequence:CCGGGTCCTCTATGTAGGTTCCAAACTCGAGTTTGGAACCTACATAGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000345
VALIDATED
SNCA MISSION shRNA Bacterial Glycerol Stock
synuclein, alpha (non A4 component of amyloid precursor)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000272292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000345.2-221s21c1
Sequence:CCGGACCAAAGAGCAAGTGACAAATCTCGAGATTTGTCACTTGCTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272344    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000345.2-922s21c1
Sequence:CCGGATGAAACTATGCACCTATAAACTCGAGTTTATAGGTGCATAGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000345.2-155s21c1
Sequence:CCGGGTTCTCTATGTAGGCTCCAAACTCGAGTTTGGAGCCTACATAGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000345.3-623s21c1
Sequence:CCGGTGACAATGAGGCTTATGAAATCTCGAGATTTCATAAGCCTCATTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000345.3-678s21c1
Sequence:CCGGGAAGCCTAAGAAATATCTTTGCTCGAGCAAAGATATTTCTTAGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000345.3-1021s21c1
Sequence:CCGGGTTAGTGATTTGCTATCATATCTCGAGATATGATAGCAAATCACTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000345.3-553s21c1
Sequence:CCGGAGGACCAGTTGGGCAAGAATGCTCGAGCATTCTTGCCCAACTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000345.x-448s1c1
Sequence:CCGGAGACTACGAACCTGAAGCCTACTCGAGTAGGCTTCAGGTTCGTAGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000345.x-383s1c1
Sequence:CCGGCTGGAAGATATGCCTGTGGATCTCGAGATCCACAGGCATATCTTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000345.x-1335s1c1
Sequence:CCGGCCTTCAATCCTGTCAATGTTTCTCGAGAAACATTGACAGGATTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000345.x-221s1c1
Sequence:CCGGACCAAAGAGCAAGTGACAAATCTCGAGATTTGTCACTTGCTCTTTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000345.x-405s1c1
Sequence:CCGGCTGACAATGAGGCTTATGAAACTCGAGTTTCATAAGCCTCATTGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000345
VALIDATED
SNCA MISSION shRNA shRNA Plasmid DNA
synuclein, alpha (non A4 component of amyloid precursor)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000272292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000345.2-221s21c1
Sequence:CCGGACCAAAGAGCAAGTGACAAATCTCGAGATTTGTCACTTGCTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272344    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000345.2-922s21c1
Sequence:CCGGATGAAACTATGCACCTATAAACTCGAGTTTATAGGTGCATAGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000345.2-155s21c1
Sequence:CCGGGTTCTCTATGTAGGCTCCAAACTCGAGTTTGGAGCCTACATAGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000345.3-623s21c1
Sequence:CCGGTGACAATGAGGCTTATGAAATCTCGAGATTTCATAAGCCTCATTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000345.3-678s21c1
Sequence:CCGGGAAGCCTAAGAAATATCTTTGCTCGAGCAAAGATATTTCTTAGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000345.3-1021s21c1
Sequence:CCGGGTTAGTGATTTGCTATCATATCTCGAGATATGATAGCAAATCACTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000345.3-553s21c1
Sequence:CCGGAGGACCAGTTGGGCAAGAATGCTCGAGCATTCTTGCCCAACTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000345.x-448s1c1
Sequence:CCGGAGACTACGAACCTGAAGCCTACTCGAGTAGGCTTCAGGTTCGTAGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000345.x-383s1c1
Sequence:CCGGCTGGAAGATATGCCTGTGGATCTCGAGATCCACAGGCATATCTTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000345.x-1335s1c1
Sequence:CCGGCCTTCAATCCTGTCAATGTTTCTCGAGAAACATTGACAGGATTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000345.x-221s1c1
Sequence:CCGGACCAAAGAGCAAGTGACAAATCTCGAGATTTGTCACTTGCTCTTTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000345.x-405s1c1
Sequence:CCGGCTGACAATGAGGCTTATGAAACTCGAGTTTCATAAGCCTCATTGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000345
VALIDATED
SNCA MISSION shRNA Lentiviral Transduction Particles
synuclein, alpha (non A4 component of amyloid precursor)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000272292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000345.2-221s21c1
Sequence:CCGGACCAAAGAGCAAGTGACAAATCTCGAGATTTGTCACTTGCTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272344    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000345.2-922s21c1
Sequence:CCGGATGAAACTATGCACCTATAAACTCGAGTTTATAGGTGCATAGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000345.2-155s21c1
Sequence:CCGGGTTCTCTATGTAGGCTCCAAACTCGAGTTTGGAGCCTACATAGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000345.3-623s21c1
Sequence:CCGGTGACAATGAGGCTTATGAAATCTCGAGATTTCATAAGCCTCATTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000345.3-678s21c1
Sequence:CCGGGAAGCCTAAGAAATATCTTTGCTCGAGCAAAGATATTTCTTAGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000345.3-1021s21c1
Sequence:CCGGGTTAGTGATTTGCTATCATATCTCGAGATATGATAGCAAATCACTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000345.3-553s21c1
Sequence:CCGGAGGACCAGTTGGGCAAGAATGCTCGAGCATTCTTGCCCAACTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000345.x-448s1c1
Sequence:CCGGAGACTACGAACCTGAAGCCTACTCGAGTAGGCTTCAGGTTCGTAGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000345.x-383s1c1
Sequence:CCGGCTGGAAGATATGCCTGTGGATCTCGAGATCCACAGGCATATCTTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000345.x-1335s1c1
Sequence:CCGGCCTTCAATCCTGTCAATGTTTCTCGAGAAACATTGACAGGATTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000345.x-221s1c1
Sequence:CCGGACCAAAGAGCAAGTGACAAATCTCGAGATTTGTCACTTGCTCTTTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000345.x-405s1c1
Sequence:CCGGCTGACAATGAGGCTTATGAAACTCGAGTTTCATAAGCCTCATTGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks