EMAIL THIS PAGE TO A FRIEND

SNCB

synuclein, beta

UniProtKB ID: Q16143, Q6IAX7
Gene ID:
Human(6620) Summary: The protein encoded by this gene is highly homologous to alpha-synuclein. These proteins are abundantly expressed in the brain and putatively inhibit phospholipase D2 selectively. The encoded protein, which may play a role in neuronal plasticity, is abundant in neurofibrillary lesions of patients with Alzheimer disease. This protein has been shown to be highly expressed in the substantia nigra of the brain, a region of neuronal degeneration in patients with Parkinson disease; however, no direct relation to Parkinson disease has been established. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(104069) synuclein, beta
Rat(113893) synuclein, beta
Zebrafish(393944) synuclein, beta
chicken(395391) synuclein, beta
domestic cat(101080866) synuclein, beta
dog(479279) synuclein, beta
cow(508421) synuclein, beta
sheep(101106009) synuclein, beta
naked mole-rat(101708817) synuclein, beta
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001502 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001502 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001502 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033610 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033610 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033610 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU037291 MISSION® esiRNA esiRNA human SNCB (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001502 Rosetta Predictions human pricing
NM_003085 Rosetta Predictions human pricing
NM_080777 Rosetta Predictions rat pricing
NM_033610 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001502 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113147 predicted 982
2 SASI_Hs01_00113148 predicted 695
3 SASI_Hs01_00113149 predicted 806
4 SASI_Hs01_00113151 predicted 683
5 SASI_Hs01_00113152 predicted 659
6 SASI_Hs01_00113153 predicted 946
7 SASI_Hs01_00113154 predicted 978
8 SASI_Hs01_00113155 predicted 703
9 SASI_Hs02_00303798 predicted 821
10 SASI_Hs02_00303799 predicted 730
11 SASI_Hs01_00113150 predicted 692
12 SASI_Hs01_00113156 predicted 944
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003085 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093496 predicted 829
2 SASI_Hs01_00093497 predicted 539
3 SASI_Hs01_00093498 predicted 656
4 SASI_Hs01_00093500 predicted 525
5 SASI_Hs01_00093501 predicted 504
6 SASI_Hs01_00093502 predicted 786
7 SASI_Hs01_00093503 predicted 823
8 SASI_Hs01_00093504 predicted 542
9 SASI_Hs02_00335011 predicted 668
10 SASI_Hs02_00335012 predicted 570
11 SASI_Hs01_00093499 predicted 529
12 SASI_Hs01_00093505 predicted 796
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080777 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091650 predicted 782
2 SASI_Rn01_00091651 predicted 286
3 SASI_Rn01_00091652 predicted 230
4 SASI_Rn01_00091653 predicted 323
5 SASI_Rn01_00091654 predicted 591
6 SASI_Rn01_00091655 predicted 375
7 SASI_Rn01_00091656 predicted 321
8 SASI_Rn01_00091657 predicted 296
9 SASI_Rn02_00267299 predicted 740
10 SASI_Rn01_00091658 predicted 581
11 SASI_Rn01_00091659 predicted 711
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033610 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173473 predicted 252
2 SASI_Mm01_00173474 predicted 216
3 SASI_Mm01_00173475 predicted 255
4 SASI_Mm01_00173476 predicted 283
5 SASI_Mm02_00337469 predicted 325
6 SASI_Mm01_00173477 predicted 250
7 SASI_Mm01_00173478 predicted 244
8 SASI_Mm01_00173479 predicted 268
9 SASI_Mm01_00173480 predicted 269
10 SASI_Mm01_00173481 predicted 271
11 SASI_Mm01_00173482 predicted 316
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001502
SNCB MISSION shRNA Bacterial Glycerol Stock
synuclein, beta
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001502.1-816s1c1
Sequence:CCGGGAGGAATATCAGGAGTATGAGCTCGAGCTCATACTCCTGATATTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001502.1-812s1c1
Sequence:CCGGCCAGGAGGAATATCAGGAGTACTCGAGTACTCCTGATATTCCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001502.1-747s1c1
Sequence:CCGGGCTGCTGAAGAACCACTGATTCTCGAGAATCAGTGGTTCTTCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001502.1-750s1c1
Sequence:CCGGGCTGAAGAACCACTGATTGAGCTCGAGCTCAATCAGTGGTTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001502.1-813s1c1
Sequence:CCGGCAGGAGGAATATCAGGAGTATCTCGAGATACTCCTGATATTCCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001502
SNCB MISSION shRNA shRNA Plasmid DNA
synuclein, beta
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001502.1-816s1c1
Sequence:CCGGGAGGAATATCAGGAGTATGAGCTCGAGCTCATACTCCTGATATTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001502.1-812s1c1
Sequence:CCGGCCAGGAGGAATATCAGGAGTACTCGAGTACTCCTGATATTCCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001502.1-747s1c1
Sequence:CCGGGCTGCTGAAGAACCACTGATTCTCGAGAATCAGTGGTTCTTCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001502.1-750s1c1
Sequence:CCGGGCTGAAGAACCACTGATTGAGCTCGAGCTCAATCAGTGGTTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001502.1-813s1c1
Sequence:CCGGCAGGAGGAATATCAGGAGTATCTCGAGATACTCCTGATATTCCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001502
SNCB MISSION shRNA Lentiviral Transduction Particles
synuclein, beta
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001502.1-816s1c1
Sequence:CCGGGAGGAATATCAGGAGTATGAGCTCGAGCTCATACTCCTGATATTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001502.1-812s1c1
Sequence:CCGGCCAGGAGGAATATCAGGAGTACTCGAGTACTCCTGATATTCCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001502.1-747s1c1
Sequence:CCGGGCTGCTGAAGAACCACTGATTCTCGAGAATCAGTGGTTCTTCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001502.1-750s1c1
Sequence:CCGGGCTGAAGAACCACTGATTGAGCTCGAGCTCAATCAGTGGTTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001502.1-813s1c1
Sequence:CCGGCAGGAGGAATATCAGGAGTATCTCGAGATACTCCTGATATTCCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033610
SNCB MISSION shRNA Bacterial Glycerol Stock
synuclein, beta
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033610.2-868s1c1
Sequence:CCGGGCTCGGATGTAGCATGTTCTACTCGAGTAGAACATGCTACATCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033610.2-253s1c1
Sequence:CCGGCGTCCTCTATGTCGGAAGCAACTCGAGTTGCTTCCGACATAGAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033610.2-511s1c1
Sequence:CCGGCCAGGAGGAATACCAGGAATACTCGAGTATTCCTGGTATTCCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033610.2-329s1c1
Sequence:CCGGGCATCGCATCTGGGAGGAGCTCTCGAGAGCTCCTCCCAGATGCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033610.2-278s1c1
Sequence:CCGGAGTGGAGTGGTACAAGGTGTACTCGAGTACACCTTGTACCACTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033610
SNCB MISSION shRNA shRNA Plasmid DNA
synuclein, beta
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033610.2-868s1c1
Sequence:CCGGGCTCGGATGTAGCATGTTCTACTCGAGTAGAACATGCTACATCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033610.2-253s1c1
Sequence:CCGGCGTCCTCTATGTCGGAAGCAACTCGAGTTGCTTCCGACATAGAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033610.2-511s1c1
Sequence:CCGGCCAGGAGGAATACCAGGAATACTCGAGTATTCCTGGTATTCCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033610.2-329s1c1
Sequence:CCGGGCATCGCATCTGGGAGGAGCTCTCGAGAGCTCCTCCCAGATGCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033610.2-278s1c1
Sequence:CCGGAGTGGAGTGGTACAAGGTGTACTCGAGTACACCTTGTACCACTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033610
SNCB MISSION shRNA Lentiviral Transduction Particles
synuclein, beta
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033610.2-868s1c1
Sequence:CCGGGCTCGGATGTAGCATGTTCTACTCGAGTAGAACATGCTACATCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033610.2-253s1c1
Sequence:CCGGCGTCCTCTATGTCGGAAGCAACTCGAGTTGCTTCCGACATAGAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033610.2-511s1c1
Sequence:CCGGCCAGGAGGAATACCAGGAATACTCGAGTATTCCTGGTATTCCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033610.2-329s1c1
Sequence:CCGGGCATCGCATCTGGGAGGAGCTCTCGAGAGCTCCTCCCAGATGCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033610.2-278s1c1
Sequence:CCGGAGTGGAGTGGTACAAGGTGTACTCGAGTACACCTTGTACCACTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks