EMAIL THIS PAGE TO A FRIEND

SNCG

synuclein, gamma (breast cancer-specific protein 1)

Synonyms: BCSG1 SR
UniProtKB ID: O76070, O15104, Q96P61
Gene ID:
Human(6623) Summary: This gene encodes a member of the synuclein family of proteins which are believed to be involved in the pathogenesis of neurodegenerative diseases. Mutations in this gene have also been associated with breast tumor development. [provided by RefSeq, Jan 2010]
Mouse(20618) synuclein, gamma
Rat(64347) synuclein, gamma (breast cancer-specific protein 1)
chicken(395392) synuclein, gamma (breast cancer-specific protein 1)
domestic cat(101086006) synuclein, gamma (breast cancer-specific protein 1)
dog(611053) synuclein, gamma (breast cancer-specific protein 1)
naked mole-rat(101700164) synuclein, gamma (breast cancer-specific protein 1)
domestic guinea pig(100722802) synuclein, gamma (breast cancer-specific protein 1)
cow(281494) synuclein, gamma (breast cancer-specific protein 1)
sheep(101113039) synuclein, gamma (breast cancer-specific protein 1)
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011430 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011430 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011430 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003087 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003087 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003087 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU041881 MISSION® esiRNA esiRNA human SNCG (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003087 Rosetta Predictions human pricing
NM_031688 Rosetta Predictions rat pricing
NM_011430 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003087 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088685 predicted 247
2 SASI_Hs01_00088687 predicted 252
3 SASI_Hs02_00335021 predicted 252
4 SASI_Hs01_00088684 predicted 364
5 SASI_Hs01_00088686 predicted 288
6 SASI_Hs01_00088688 predicted 298
7 SASI_Hs01_00088689 predicted 284
8 SASI_Hs02_00335022 predicted 207
9 SASI_Hs01_00088690 predicted 434
10 SASI_Hs01_00088692 predicted 362
11 SASI_Hs01_00088691 predicted 439
12 SASI_Hs01_00088693 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031688 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092585 predicted 396
2 SASI_Rn01_00092586 predicted 284
3 SASI_Rn01_00092587 predicted 422
4 SASI_Rn01_00092588 predicted 255
5 SASI_Rn01_00092589 predicted 254
6 SASI_Rn01_00092590 predicted 387
7 SASI_Rn01_00092591 predicted 224
8 SASI_Rn01_00092592 predicted 406
9 SASI_Rn01_00092593 predicted 231
10 SASI_Rn01_00092594 predicted 409
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011430 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145455 predicted 210
2 SASI_Mm01_00145456 predicted 276
3 SASI_Mm01_00145457 predicted 370
4 SASI_Mm01_00145458 predicted 246
5 SASI_Mm01_00145459 predicted 196
6 SASI_Mm01_00145460 predicted 253
7 SASI_Mm01_00145461 predicted 400
8 SASI_Mm01_00145462 predicted 258
9 SASI_Mm01_00145463 predicted 385
10 SASI_Mm01_00145464 predicted 627
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011430
SNCG MISSION shRNA Bacterial Glycerol Stock
synuclein, gamma (breast cancer-specific protein 1)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000106580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011430.1-506s1c1
Sequence:CCGGGCACACTGAATGCCCTGCCTACTCGAGTAGGCAGGGCATTCAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011430.1-210s1c1
Sequence:CCGGGTGGTACAAAGTGTCACCTCACTCGAGTGAGGTGACACTTTGTACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011430.1-262s1c1
Sequence:CCGGCCGTGAGTGAAGCTGTGGTCACTCGAGTGACCACAGCTTCACTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011430.1-393s1c1
Sequence:CCGGGCCAAAGAGCAAGAGGAGAATCTCGAGATTCTCCTCTTGCTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011430
SNCG MISSION shRNA shRNA Plasmid DNA
synuclein, gamma (breast cancer-specific protein 1)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000106580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011430.1-506s1c1
Sequence:CCGGGCACACTGAATGCCCTGCCTACTCGAGTAGGCAGGGCATTCAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011430.1-210s1c1
Sequence:CCGGGTGGTACAAAGTGTCACCTCACTCGAGTGAGGTGACACTTTGTACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011430.1-262s1c1
Sequence:CCGGCCGTGAGTGAAGCTGTGGTCACTCGAGTGACCACAGCTTCACTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011430.1-393s1c1
Sequence:CCGGGCCAAAGAGCAAGAGGAGAATCTCGAGATTCTCCTCTTGCTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011430
SNCG MISSION shRNA Lentiviral Transduction Particles
synuclein, gamma (breast cancer-specific protein 1)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000106580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011430.1-506s1c1
Sequence:CCGGGCACACTGAATGCCCTGCCTACTCGAGTAGGCAGGGCATTCAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011430.1-210s1c1
Sequence:CCGGGTGGTACAAAGTGTCACCTCACTCGAGTGAGGTGACACTTTGTACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011430.1-262s1c1
Sequence:CCGGCCGTGAGTGAAGCTGTGGTCACTCGAGTGACCACAGCTTCACTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011430.1-393s1c1
Sequence:CCGGGCCAAAGAGCAAGAGGAGAATCTCGAGATTCTCCTCTTGCTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003087
SNCG MISSION shRNA Bacterial Glycerol Stock
synuclein, gamma (breast cancer-specific protein 1)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003087.1-179s1c1
Sequence:CCGGCCAAGGAGAATGTTGTACAGACTCGAGTCTGTACAACATTCTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003087.1-380s1c1
Sequence:CCGGCATCCAAAGAGAAAGAGGAAGCTCGAGCTTCCTCTTTCTCTTTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003087.1-177s1c1
Sequence:CCGGGACCAAGGAGAATGTTGTACACTCGAGTGTACAACATTCTCCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003087.1-379s1c1
Sequence:CCGGGCATCCAAAGAGAAAGAGGAACTCGAGTTCCTCTTTCTCTTTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003087.1-180s1c1
Sequence:CCGGCAAGGAGAATGTTGTACAGAGCTCGAGCTCTGTACAACATTCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003087.1-174s1c1
Sequence:CCGGCAAGACCAAGGAGAATGTTGTCTCGAGACAACATTCTCCTTGGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003087.1-172s1c1
Sequence:CCGGGCCAAGACCAAGGAGAATGTTCTCGAGAACATTCTCCTTGGTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003087.2-277s21c1
Sequence:CCGGTCATGTATGTGGGAGCCAAGACTCGAGTCTTGGCTCCCACATACATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003087.2-249s21c1
Sequence:CCGGGAAGCAGCTGAGAAGACCAAGCTCGAGCTTGGTCTTCTCAGCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003087
SNCG MISSION shRNA shRNA Plasmid DNA
synuclein, gamma (breast cancer-specific protein 1)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003087.1-179s1c1
Sequence:CCGGCCAAGGAGAATGTTGTACAGACTCGAGTCTGTACAACATTCTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003087.1-380s1c1
Sequence:CCGGCATCCAAAGAGAAAGAGGAAGCTCGAGCTTCCTCTTTCTCTTTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003087.1-177s1c1
Sequence:CCGGGACCAAGGAGAATGTTGTACACTCGAGTGTACAACATTCTCCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003087.1-379s1c1
Sequence:CCGGGCATCCAAAGAGAAAGAGGAACTCGAGTTCCTCTTTCTCTTTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003087.1-180s1c1
Sequence:CCGGCAAGGAGAATGTTGTACAGAGCTCGAGCTCTGTACAACATTCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003087.1-174s1c1
Sequence:CCGGCAAGACCAAGGAGAATGTTGTCTCGAGACAACATTCTCCTTGGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003087.1-172s1c1
Sequence:CCGGGCCAAGACCAAGGAGAATGTTCTCGAGAACATTCTCCTTGGTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003087.2-277s21c1
Sequence:CCGGTCATGTATGTGGGAGCCAAGACTCGAGTCTTGGCTCCCACATACATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003087.2-249s21c1
Sequence:CCGGGAAGCAGCTGAGAAGACCAAGCTCGAGCTTGGTCTTCTCAGCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003087
SNCG MISSION shRNA Lentiviral Transduction Particles
synuclein, gamma (breast cancer-specific protein 1)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003087.1-179s1c1
Sequence:CCGGCCAAGGAGAATGTTGTACAGACTCGAGTCTGTACAACATTCTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003087.1-380s1c1
Sequence:CCGGCATCCAAAGAGAAAGAGGAAGCTCGAGCTTCCTCTTTCTCTTTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003087.1-177s1c1
Sequence:CCGGGACCAAGGAGAATGTTGTACACTCGAGTGTACAACATTCTCCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003087.1-379s1c1
Sequence:CCGGGCATCCAAAGAGAAAGAGGAACTCGAGTTCCTCTTTCTCTTTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003087.1-180s1c1
Sequence:CCGGCAAGGAGAATGTTGTACAGAGCTCGAGCTCTGTACAACATTCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003087.1-174s1c1
Sequence:CCGGCAAGACCAAGGAGAATGTTGTCTCGAGACAACATTCTCCTTGGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003087.1-172s1c1
Sequence:CCGGGCCAAGACCAAGGAGAATGTTCTCGAGAACATTCTCCTTGGTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003087.2-277s21c1
Sequence:CCGGTCATGTATGTGGGAGCCAAGACTCGAGTCTTGGCTCCCACATACATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003087.2-249s21c1
Sequence:CCGGGAAGCAGCTGAGAAGACCAAGCTCGAGCTTGGTCTTCTCAGCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks