EMAIL THIS PAGE TO A FRIEND

SND1-IT1

SND1 intronic transcript 1 (non-protein coding)

Synonyms: C7orf54 NAG8 NSG-X
Species: Human SND1-IT1(27099)
UniProtKB ID: Q9HBX3, B3KNA6, O95358
Gene ID:
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014411 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014411 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014411 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014411 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014411 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093736 predicted 745
2 SASI_Hs01_00093737 predicted 747
3 SASI_Hs01_00093735 predicted 1006
4 SASI_Hs01_00093738 predicted 207
5 SASI_Hs01_00093739 predicted 245
6 SASI_Hs01_00093740 predicted 733
7 SASI_Hs01_00093742 predicted 193
8 SASI_Hs01_00093743 predicted 736
9 SASI_Hs01_00093744 predicted 804
10 SASI_Hs02_00345602 predicted 299
11 SASI_Hs01_00093741 predicted 282
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014411
SND1-IT1 MISSION shRNA Bacterial Glycerol Stock
SND1 intronic transcript 1 (non-protein coding)
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183100    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014411.1-1086s1c1
Sequence:CCGGCCAGGTTGTTATCTGTCTATTCTCGAGAATAGACAGATAACAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180642    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014411.1-283s1c1
Sequence:CCGGCCCATCTCTCAGGTAGACTTACTCGAGTAAGTCTACCTGAGAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179492    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014411.1-341s1c1
Sequence:CCGGGCTTTCCTATTCACTCCTGTTCTCGAGAACAGGAGTGAATAGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014411.1-221s1c1
Sequence:CCGGCCTTATCAGAATGGACCTGTTCTCGAGAACAGGTCCATTCTGATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014411
SND1-IT1 MISSION shRNA shRNA Plasmid DNA
SND1 intronic transcript 1 (non-protein coding)
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183100    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014411.1-1086s1c1
Sequence:CCGGCCAGGTTGTTATCTGTCTATTCTCGAGAATAGACAGATAACAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180642    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014411.1-283s1c1
Sequence:CCGGCCCATCTCTCAGGTAGACTTACTCGAGTAAGTCTACCTGAGAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179492    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014411.1-341s1c1
Sequence:CCGGGCTTTCCTATTCACTCCTGTTCTCGAGAACAGGAGTGAATAGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014411.1-221s1c1
Sequence:CCGGCCTTATCAGAATGGACCTGTTCTCGAGAACAGGTCCATTCTGATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014411
SND1-IT1 MISSION shRNA Lentiviral Transduction Particles
SND1 intronic transcript 1 (non-protein coding)
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183100    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014411.1-1086s1c1
Sequence:CCGGCCAGGTTGTTATCTGTCTATTCTCGAGAATAGACAGATAACAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180642    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014411.1-283s1c1
Sequence:CCGGCCCATCTCTCAGGTAGACTTACTCGAGTAAGTCTACCTGAGAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179492    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014411.1-341s1c1
Sequence:CCGGGCTTTCCTATTCACTCCTGTTCTCGAGAACAGGAGTGAATAGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014411.1-221s1c1
Sequence:CCGGCCTTATCAGAATGGACCTGTTCTCGAGAACAGGTCCATTCTGATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks