EMAIL THIS PAGE TO A FRIEND

SND1

staphylococcal nuclease and tudor domain containing 1

Synonyms: TDRD11 p100
UniProtKB ID: Q7KZF4, Q13122, Q96AG0
Gene ID:
Mouse(56463) staphylococcal nuclease and tudor domain containing 1
Rat(64635) staphylococcal nuclease and tudor domain containing 1
Zebrafish(324404) staphylococcal nuclease domain containing 1
dog(475204) staphylococcal nuclease and tudor domain containing 1
chicken(373966) staphylococcal nuclease and tudor domain containing
cow(404098) staphylococcal nuclease and tudor domain containing 1
sheep(101103642) staphylococcal nuclease and tudor domain containing 1
domestic guinea pig(100726680) staphylococcal nuclease and tudor domain containing 1
naked mole-rat(101724008) staphylococcal nuclease and tudor domain containing 1
105 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019776 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019776 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019776 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014390 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014390 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014390 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014390 Rosetta Predictions human pricing
NM_022694 Rosetta Predictions rat pricing
NM_019776 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014390 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172332 predicted 1313
2 SASI_Hs01_00172333 predicted 1718
3 SASI_Hs01_00172334 predicted 478
4 SASI_Hs02_00345570 predicted 2278
5 SASI_Hs01_00172335 predicted 1452
6 SASI_Hs01_00172337 predicted 632
7 SASI_Hs02_00345571 predicted 2563
8 SASI_Hs01_00172338 predicted 2258
9 SASI_Hs01_00172339 predicted 2910
10 SASI_Hs01_00172340 predicted 2675
11 SASI_Hs01_00172336 predicted 736
12 SASI_Hs01_00172341 predicted 2605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022694 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053327 predicted 656
2 SASI_Rn01_00053328 predicted 2905
3 SASI_Rn02_00263486 predicted 896
4 SASI_Rn02_00263487 predicted 2241
5 SASI_Rn01_00053329 predicted 438
6 SASI_Rn01_00053330 predicted 2193
7 SASI_Rn01_00053331 predicted 1017
8 SASI_Rn01_00053332 predicted 2000
9 SASI_Rn01_00053334 predicted 795
10 SASI_Rn01_00053335 predicted 610
11 SASI_Rn01_00053333 predicted 1423
12 SASI_Rn01_00053336 predicted 2583
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019776 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089656 predicted 1348
2 SASI_Mm01_00089657 predicted 2832
3 SASI_Mm01_00089658 predicted 1200
4 SASI_Mm01_00089659 predicted 2841
5 SASI_Mm01_00089660 predicted 1441
6 SASI_Mm01_00089661 predicted 375
7 SASI_Mm01_00089662 predicted 455
8 SASI_Mm01_00089663 predicted 2017
9 SASI_Mm01_00089664 predicted 479
10 SASI_Mm01_00089665 predicted 2258
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019776
VALIDATED
SND1 MISSION shRNA Bacterial Glycerol Stock
staphylococcal nuclease and tudor domain containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019776.2-3025s21c1
Sequence:CCGGGACCTGGTTGAGGGAGTATAGCTCGAGCTATACTCCCTCAACCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019776.2-2563s21c1
Sequence:CCGGTGCCTTCAGCACGCGTGTATTCTCGAGAATACACGCGTGCTGAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019776.2-742s21c1
Sequence:CCGGCCTCAAGTACACCATTGAGAACTCGAGTTCTCAATGGTGTACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019776.2-2494s21c1
Sequence:CCGGGCATGTCTTCTACATCGACTACTCGAGTAGTCGATGTAGAAGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019776.2-1829s21c1
Sequence:CCGGTCTCGCCTCAAGCTCTATTTACTCGAGTAAATAGAGCTTGAGGCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019776.1-1169s1c1
Sequence:CCGGCCACTGCTAATTTGGACCAAACTCGAGTTTGGTCCAAATTAGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019776.1-2451s1c1
Sequence:CCGGGCATGTCTTCTACATCGACTACTCGAGTAGTCGATGTAGAAGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019776.1-699s1c1
Sequence:CCGGCCTCAAGTACACCATTGAGAACTCGAGTTCTCAATGGTGTACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019776.1-433s1c1
Sequence:CCGGCGCAAGAAGCTGATTGGGAAACTCGAGTTTCCCAATCAGCTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019776.1-2386s1c1
Sequence:CCGGGCCAAATTTGTAGATGGAGAACTCGAGTTCTCCATCTACAAATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019776
VALIDATED
SND1 MISSION shRNA shRNA Plasmid DNA
staphylococcal nuclease and tudor domain containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019776.2-3025s21c1
Sequence:CCGGGACCTGGTTGAGGGAGTATAGCTCGAGCTATACTCCCTCAACCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019776.2-2563s21c1
Sequence:CCGGTGCCTTCAGCACGCGTGTATTCTCGAGAATACACGCGTGCTGAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019776.2-742s21c1
Sequence:CCGGCCTCAAGTACACCATTGAGAACTCGAGTTCTCAATGGTGTACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019776.2-2494s21c1
Sequence:CCGGGCATGTCTTCTACATCGACTACTCGAGTAGTCGATGTAGAAGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019776.2-1829s21c1
Sequence:CCGGTCTCGCCTCAAGCTCTATTTACTCGAGTAAATAGAGCTTGAGGCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019776.1-1169s1c1
Sequence:CCGGCCACTGCTAATTTGGACCAAACTCGAGTTTGGTCCAAATTAGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019776.1-2451s1c1
Sequence:CCGGGCATGTCTTCTACATCGACTACTCGAGTAGTCGATGTAGAAGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019776.1-699s1c1
Sequence:CCGGCCTCAAGTACACCATTGAGAACTCGAGTTCTCAATGGTGTACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019776.1-433s1c1
Sequence:CCGGCGCAAGAAGCTGATTGGGAAACTCGAGTTTCCCAATCAGCTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019776.1-2386s1c1
Sequence:CCGGGCCAAATTTGTAGATGGAGAACTCGAGTTCTCCATCTACAAATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019776
VALIDATED
SND1 MISSION shRNA Lentiviral Transduction Particles
staphylococcal nuclease and tudor domain containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019776.2-3025s21c1
Sequence:CCGGGACCTGGTTGAGGGAGTATAGCTCGAGCTATACTCCCTCAACCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019776.2-2563s21c1
Sequence:CCGGTGCCTTCAGCACGCGTGTATTCTCGAGAATACACGCGTGCTGAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019776.2-742s21c1
Sequence:CCGGCCTCAAGTACACCATTGAGAACTCGAGTTCTCAATGGTGTACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019776.2-2494s21c1
Sequence:CCGGGCATGTCTTCTACATCGACTACTCGAGTAGTCGATGTAGAAGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019776.2-1829s21c1
Sequence:CCGGTCTCGCCTCAAGCTCTATTTACTCGAGTAAATAGAGCTTGAGGCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019776.1-1169s1c1
Sequence:CCGGCCACTGCTAATTTGGACCAAACTCGAGTTTGGTCCAAATTAGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019776.1-2451s1c1
Sequence:CCGGGCATGTCTTCTACATCGACTACTCGAGTAGTCGATGTAGAAGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019776.1-699s1c1
Sequence:CCGGCCTCAAGTACACCATTGAGAACTCGAGTTCTCAATGGTGTACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019776.1-433s1c1
Sequence:CCGGCGCAAGAAGCTGATTGGGAAACTCGAGTTTCCCAATCAGCTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019776.1-2386s1c1
Sequence:CCGGGCCAAATTTGTAGATGGAGAACTCGAGTTCTCCATCTACAAATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014390
VALIDATED
SND1 MISSION shRNA Bacterial Glycerol Stock
staphylococcal nuclease and tudor domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_014390.2-635s21c1
Sequence:CCGGGAAGGCATGAGAGCTAATAATCTCGAGATTATTAGCTCTCATGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014390.2-1838s21c1
Sequence:CCGGTCTCGTCTCAAACTCTATTTGCTCGAGCAAATAGAGTTTGAGACGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245144    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014390.2-3278s21c1
Sequence:CCGGTAGTGGAGGGAGTAATCCTAACTCGAGTTAGGATTACTCCCTCCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014390.2-2924s21c1
Sequence:CCGGGCTGATGATGCAGACGAATTTCTCGAGAAATTCGTCTGCATCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014390.2-1213s21c1
Sequence:CCGGTGTGGCTCCCACAGCTAATTTCTCGAGAAATTAGCTGTGGGAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014390.1-2890s1c1
Sequence:CCGGGCTGATGATGCAGACGAATTTCTCGAGAAATTCGTCTGCATCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_014390.1-712s1c1
Sequence:CCGGCGGGATCTCAAGTATACCATTCTCGAGAATGGTATACTTGAGATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014390.1-1824s1c1
Sequence:CCGGGCCAAAGGAAACTTGCCTTATCTCGAGATAAGGCAAGTTTCCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_014390.1-510s1c1
Sequence:CCGGGCGAGAGTATGGCATGATCTACTCGAGTAGATCATGCCATACTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014390.1-1186s1c1
Sequence:CCGGCCCACAGCTAATTTGGACCAACTCGAGTTGGTCCAAATTAGCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014390
VALIDATED
SND1 MISSION shRNA shRNA Plasmid DNA
staphylococcal nuclease and tudor domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_014390.2-635s21c1
Sequence:CCGGGAAGGCATGAGAGCTAATAATCTCGAGATTATTAGCTCTCATGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014390.2-1838s21c1
Sequence:CCGGTCTCGTCTCAAACTCTATTTGCTCGAGCAAATAGAGTTTGAGACGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245144    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014390.2-3278s21c1
Sequence:CCGGTAGTGGAGGGAGTAATCCTAACTCGAGTTAGGATTACTCCCTCCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014390.2-2924s21c1
Sequence:CCGGGCTGATGATGCAGACGAATTTCTCGAGAAATTCGTCTGCATCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014390.2-1213s21c1
Sequence:CCGGTGTGGCTCCCACAGCTAATTTCTCGAGAAATTAGCTGTGGGAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014390.1-2890s1c1
Sequence:CCGGGCTGATGATGCAGACGAATTTCTCGAGAAATTCGTCTGCATCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_014390.1-712s1c1
Sequence:CCGGCGGGATCTCAAGTATACCATTCTCGAGAATGGTATACTTGAGATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014390.1-1824s1c1
Sequence:CCGGGCCAAAGGAAACTTGCCTTATCTCGAGATAAGGCAAGTTTCCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_014390.1-510s1c1
Sequence:CCGGGCGAGAGTATGGCATGATCTACTCGAGTAGATCATGCCATACTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014390.1-1186s1c1
Sequence:CCGGCCCACAGCTAATTTGGACCAACTCGAGTTGGTCCAAATTAGCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014390
VALIDATED
SND1 MISSION shRNA Lentiviral Transduction Particles
staphylococcal nuclease and tudor domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_014390.2-635s21c1
Sequence:CCGGGAAGGCATGAGAGCTAATAATCTCGAGATTATTAGCTCTCATGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014390.2-1838s21c1
Sequence:CCGGTCTCGTCTCAAACTCTATTTGCTCGAGCAAATAGAGTTTGAGACGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245144    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014390.2-3278s21c1
Sequence:CCGGTAGTGGAGGGAGTAATCCTAACTCGAGTTAGGATTACTCCCTCCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014390.2-2924s21c1
Sequence:CCGGGCTGATGATGCAGACGAATTTCTCGAGAAATTCGTCTGCATCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014390.2-1213s21c1
Sequence:CCGGTGTGGCTCCCACAGCTAATTTCTCGAGAAATTAGCTGTGGGAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014390.1-2890s1c1
Sequence:CCGGGCTGATGATGCAGACGAATTTCTCGAGAAATTCGTCTGCATCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_014390.1-712s1c1
Sequence:CCGGCGGGATCTCAAGTATACCATTCTCGAGAATGGTATACTTGAGATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014390.1-1824s1c1
Sequence:CCGGGCCAAAGGAAACTTGCCTTATCTCGAGATAAGGCAAGTTTCCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_014390.1-510s1c1
Sequence:CCGGGCGAGAGTATGGCATGATCTACTCGAGTAGATCATGCCATACTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014390.1-1186s1c1
Sequence:CCGGCCCACAGCTAATTTGGACCAACTCGAGTTGGTCCAAATTAGCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks