EMAIL THIS PAGE TO A FRIEND

SNRPB

small nuclear ribonucleoprotein polypeptides B and B1

Synonyms: COD SNRPB1 Sm-B/B' SmB/B' SmB/SmB' snRNP-B
UniProtKB ID: P14678, Q15490, Q6IB35, Q9UIS5
Gene ID:
Human(6628) Summary: The protein encoded by this gene is one of several nuclear proteins that are found in common among U1, U2, U4/U6, and U5 small ribonucleoprotein particles (snRNPs). These snRNPs are involved in pre-mRNA splicing, and the encoded protein may also play a role in pre-mRNA splicing or snRNP structure. Autoantibodies from patients with systemic lupus erythematosus frequently recognize epitopes on the encoded protein. Two transcript variants encoding different isoforms (B and B') have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(20638) small nuclear ribonucleoprotein B
Rat(171365) small nuclear ribonucleoprotein polypeptides B and B1
cow(613304) small nuclear ribonucleoprotein polypeptides B and B1
sheep(101104770) small nuclear ribonucleoprotein polypeptides B and B1
domestic guinea pig(100722475) small nuclear ribonucleoprotein polypeptides B and B1
naked mole-rat(101708266) small nuclear ribonucleoprotein polypeptides B and B1
Zebrafish(402966) small nuclear ribonucleoprotein polypeptides B and B1
domestic cat(101099709) small nuclear ribonucleoprotein polypeptides B and B1
dog(485806) small nuclear ribonucleoprotein polypeptides B and B1
chicken(395298) small nuclear ribonucleoprotein polypeptides B and B1
106 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009225 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009225 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009225 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198216 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198216 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198216 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003091 Rosetta Predictions human pricing
NM_198216 Rosetta Predictions human pricing
NM_134358 Rosetta Predictions rat pricing
NM_009225 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003091 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108726 predicted 316
2 SASI_Hs01_00108728 predicted 322
3 SASI_Hs01_00108729 predicted 432
4 SASI_Hs01_00108730 predicted 316
5 SASI_Hs01_00108732 predicted 205
6 SASI_Hs01_00108733 predicted 433
7 SASI_Hs01_00108734 predicted 417
8 SASI_Hs01_00108735 predicted 355
9 SASI_Hs02_00335038 predicted 321
10 SASI_Hs02_00335039 predicted 597
11 SASI_Hs01_00108727 predicted 390
12 SASI_Hs01_00108731 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198216 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164934 predicted 315
2 SASI_Hs01_00164936 predicted 325
3 SASI_Hs01_00164937 predicted 426
4 SASI_Hs01_00164938 predicted 316
5 SASI_Hs01_00164940 predicted 203
6 SASI_Hs01_00164941 predicted 428
7 SASI_Hs01_00164942 predicted 414
8 SASI_Hs01_00164943 predicted 350
9 SASI_Hs02_00371747 predicted 316
10 SASI_Hs02_00371748 predicted 596
11 SASI_Hs01_00164935 predicted 388
12 SASI_Hs01_00164939 predicted 330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134358 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267912 predicted 246
2 SASI_Rn02_00267913 predicted 258
3 SASI_Rn02_00267914 predicted 253
4 SASI_Rn02_00267915 predicted 255
5 SASI_Rn02_00267916 predicted 765
6 SASI_Rn02_00267917 predicted 705
7 SASI_Rn02_00267918 predicted 312
8 SASI_Rn02_00267919 predicted 790
9 SASI_Rn02_00267920 predicted 296
10 SASI_Rn02_00267921 predicted 489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009225 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315669 predicted 279
2 SASI_Mm02_00315670 predicted 316
3 SASI_Mm01_00148705 predicted 522
4 SASI_Mm01_00148706 predicted 241
5 SASI_Mm01_00148707 predicted 223
6 SASI_Mm01_00148708 predicted 221
7 SASI_Mm01_00148710 predicted 808
8 SASI_Mm01_00148712 predicted 232
9 SASI_Mm01_00148713 predicted 342
10 SASI_Mm02_00315671 predicted 799
11 SASI_Mm01_00148709 predicted 625
12 SASI_Mm01_00148711 predicted 661
13 SASI_Mm01_00148714 predicted 1352
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009225
VALIDATED
SNRPB MISSION shRNA Bacterial Glycerol Stock
small nuclear ribonucleoprotein polypeptides B and B1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009225.2-510s21c1
Sequence:CCGGGCTGGGCCAGTCCGAGGTGTTCTCGAGAACACCTCGGACTGGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009225.2-294s21c1
Sequence:CCGGTCCAAACAAGCAGAAAGGGAACTCGAGTTCCCTTTCTGCTTGTTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009225.2-752s21c1
Sequence:CCGGCCGAGGAACTCCAATGGGCATCTCGAGATGCCCATTGGAGTTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309921    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009225.2-897s21c2
Sequence:CCGGCCTGTTTGTTTGTTATGCAGTCTCGAGACTGCATAACAAACAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009225.1-749s1c1
Sequence:CCGGTCCAAACAAGCAGAAAGGGAACTCGAGTTCCCTTTCTGCTTGTTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009225.1-1207s1c1
Sequence:CCGGCCGAGGAACTCCAATGGGCATCTCGAGATGCCCATTGGAGTTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109265    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009225.1-1352s1c1
Sequence:CCGGCCTGTTTGTTTGTTATGCAGTCTCGAGACTGCATAACAAACAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009225.1-839s1c1
Sequence:CCGGCCTCCCAAAGATACTGGCATTCTCGAGAATGCCAGTATCTTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009225
VALIDATED
SNRPB MISSION shRNA shRNA Plasmid DNA
small nuclear ribonucleoprotein polypeptides B and B1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009225.2-510s21c1
Sequence:CCGGGCTGGGCCAGTCCGAGGTGTTCTCGAGAACACCTCGGACTGGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009225.2-294s21c1
Sequence:CCGGTCCAAACAAGCAGAAAGGGAACTCGAGTTCCCTTTCTGCTTGTTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009225.2-752s21c1
Sequence:CCGGCCGAGGAACTCCAATGGGCATCTCGAGATGCCCATTGGAGTTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309921    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009225.2-897s21c2
Sequence:CCGGCCTGTTTGTTTGTTATGCAGTCTCGAGACTGCATAACAAACAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009225.1-749s1c1
Sequence:CCGGTCCAAACAAGCAGAAAGGGAACTCGAGTTCCCTTTCTGCTTGTTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009225.1-1207s1c1
Sequence:CCGGCCGAGGAACTCCAATGGGCATCTCGAGATGCCCATTGGAGTTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109265    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009225.1-1352s1c1
Sequence:CCGGCCTGTTTGTTTGTTATGCAGTCTCGAGACTGCATAACAAACAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009225.1-839s1c1
Sequence:CCGGCCTCCCAAAGATACTGGCATTCTCGAGAATGCCAGTATCTTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009225
VALIDATED
SNRPB MISSION shRNA Lentiviral Transduction Particles
small nuclear ribonucleoprotein polypeptides B and B1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009225.2-510s21c1
Sequence:CCGGGCTGGGCCAGTCCGAGGTGTTCTCGAGAACACCTCGGACTGGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009225.2-294s21c1
Sequence:CCGGTCCAAACAAGCAGAAAGGGAACTCGAGTTCCCTTTCTGCTTGTTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009225.2-752s21c1
Sequence:CCGGCCGAGGAACTCCAATGGGCATCTCGAGATGCCCATTGGAGTTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309921    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009225.2-897s21c2
Sequence:CCGGCCTGTTTGTTTGTTATGCAGTCTCGAGACTGCATAACAAACAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009225.1-749s1c1
Sequence:CCGGTCCAAACAAGCAGAAAGGGAACTCGAGTTCCCTTTCTGCTTGTTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009225.1-1207s1c1
Sequence:CCGGCCGAGGAACTCCAATGGGCATCTCGAGATGCCCATTGGAGTTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109265    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009225.1-1352s1c1
Sequence:CCGGCCTGTTTGTTTGTTATGCAGTCTCGAGACTGCATAACAAACAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009225.1-839s1c1
Sequence:CCGGCCTCCCAAAGATACTGGCATTCTCGAGAATGCCAGTATCTTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198216
VALIDATED
SNRPB MISSION shRNA Bacterial Glycerol Stock
small nuclear ribonucleoprotein polypeptides B and B1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198216.1-272s21c1
Sequence:CCGGCACATGAATTTGATCCTCTGTCTCGAGACAGAGGATCAAATTCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198216.1-593s21c1
Sequence:CCGGCCACAAGGAAGAGGTACTGTTCTCGAGAACAGTACCTCTTCCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198216.1-419s21c1
Sequence:CCGGCCTCCCAAAGATACTGGTATTCTCGAGAATACCAGTATCTTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198216.1-318s21c1
Sequence:CCGGAGCCAAAGAACTCCAAACAAGCTCGAGCTTGTTTGGAGTTCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198216.1-391s21c1
Sequence:CCGGTCTGGTCTCAATGACAGTAGACTCGAGTCTACTGTCATTGAGACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198216.1-193s1c1
Sequence:CCGGGCAGCATATTGATTACAGGATCTCGAGATCCTGTAATCAATATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_198216.1-419s1c1
Sequence:CCGGCCTCCCAAAGATACTGGTATTCTCGAGAATACCAGTATCTTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_198216.1-593s1c1
Sequence:CCGGCCACAAGGAAGAGGTACTGTTCTCGAGAACAGTACCTCTTCCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198216.1-739s1c1
Sequence:CCGGTCCTGGTATGAGACCTCCTATCTCGAGATAGGAGGTCTCATACCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_198216.1-272s1c1
Sequence:CCGGCACATGAATTTGATCCTCTGTCTCGAGACAGAGGATCAAATTCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198216
VALIDATED
SNRPB MISSION shRNA shRNA Plasmid DNA
small nuclear ribonucleoprotein polypeptides B and B1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198216.1-272s21c1
Sequence:CCGGCACATGAATTTGATCCTCTGTCTCGAGACAGAGGATCAAATTCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198216.1-593s21c1
Sequence:CCGGCCACAAGGAAGAGGTACTGTTCTCGAGAACAGTACCTCTTCCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198216.1-419s21c1
Sequence:CCGGCCTCCCAAAGATACTGGTATTCTCGAGAATACCAGTATCTTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198216.1-318s21c1
Sequence:CCGGAGCCAAAGAACTCCAAACAAGCTCGAGCTTGTTTGGAGTTCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198216.1-391s21c1
Sequence:CCGGTCTGGTCTCAATGACAGTAGACTCGAGTCTACTGTCATTGAGACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198216.1-193s1c1
Sequence:CCGGGCAGCATATTGATTACAGGATCTCGAGATCCTGTAATCAATATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_198216.1-419s1c1
Sequence:CCGGCCTCCCAAAGATACTGGTATTCTCGAGAATACCAGTATCTTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_198216.1-593s1c1
Sequence:CCGGCCACAAGGAAGAGGTACTGTTCTCGAGAACAGTACCTCTTCCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198216.1-739s1c1
Sequence:CCGGTCCTGGTATGAGACCTCCTATCTCGAGATAGGAGGTCTCATACCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_198216.1-272s1c1
Sequence:CCGGCACATGAATTTGATCCTCTGTCTCGAGACAGAGGATCAAATTCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198216
VALIDATED
SNRPB MISSION shRNA Lentiviral Transduction Particles
small nuclear ribonucleoprotein polypeptides B and B1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198216.1-272s21c1
Sequence:CCGGCACATGAATTTGATCCTCTGTCTCGAGACAGAGGATCAAATTCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198216.1-593s21c1
Sequence:CCGGCCACAAGGAAGAGGTACTGTTCTCGAGAACAGTACCTCTTCCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198216.1-419s21c1
Sequence:CCGGCCTCCCAAAGATACTGGTATTCTCGAGAATACCAGTATCTTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198216.1-318s21c1
Sequence:CCGGAGCCAAAGAACTCCAAACAAGCTCGAGCTTGTTTGGAGTTCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198216.1-391s21c1
Sequence:CCGGTCTGGTCTCAATGACAGTAGACTCGAGTCTACTGTCATTGAGACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198216.1-193s1c1
Sequence:CCGGGCAGCATATTGATTACAGGATCTCGAGATCCTGTAATCAATATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_198216.1-419s1c1
Sequence:CCGGCCTCCCAAAGATACTGGTATTCTCGAGAATACCAGTATCTTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_198216.1-593s1c1
Sequence:CCGGCCACAAGGAAGAGGTACTGTTCTCGAGAACAGTACCTCTTCCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198216.1-739s1c1
Sequence:CCGGTCCTGGTATGAGACCTCCTATCTCGAGATAGGAGGTCTCATACCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_198216.1-272s1c1
Sequence:CCGGCACATGAATTTGATCCTCTGTCTCGAGACAGAGGATCAAATTCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks