EMAIL THIS PAGE TO A FRIEND

SNRPC

small nuclear ribonucleoprotein polypeptide C

Synonyms: U1C Yhc1
UniProtKB ID: P09234, Q5TAL3
Gene ID:
Human(6631) Summary: This gene encodes one of the specific protein components of the U1 small nuclear ribonucleoprotein (snRNP) particle required for the formation of the spliceosome. The encoded protein participates in the processing of nuclear precursor messenger RNA splicing. snRNP particles are attacked by autoantibodies frequently produced by patients with connective tissue diseases. The genome contains several pseudogenes of this functional gene. Alternative splicing results in a non-coding transcript variant.[provided by RefSeq, Oct 2009]
Mouse(20630) U1 small nuclear ribonucleoprotein C
Rat(361808) small nuclear ribonucleoprotein polypeptide C
Zebrafish(192330) small nuclear ribonucleoprotein polypeptide C
chicken(419901) small nuclear ribonucleoprotein polypeptide C
dog(608109) small nuclear ribonucleoprotein polypeptide C
domestic cat(101096729) small nuclear ribonucleoprotein polypeptide C
cow(614553) small nuclear ribonucleoprotein polypeptide C
sheep(101116434) small nuclear ribonucleoprotein polypeptide C
domestic guinea pig(100732863) small nuclear ribonucleoprotein polypeptide C
naked mole-rat(101697231) small nuclear ribonucleoprotein polypeptide C
103 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003093 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003093 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003093 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011432 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011432 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011432 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003093 Rosetta Predictions human pricing
XM_001078182 Rosetta Predictions rat pricing
XM_342101 Rosetta Predictions rat pricing
NM_011432 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003093 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141349 predicted 204
2 SASI_Hs01_00141350 predicted 426
3 SASI_Hs01_00141351 predicted 391
4 SASI_Hs01_00141352 predicted 460
5 SASI_Hs01_00141348 predicted 198
6 SASI_Hs01_00141353 predicted 454
7 SASI_Hs01_00141354 predicted 450
8 SASI_Hs01_00141355 predicted 390
9 SASI_Hs01_00141356 predicted 144
10 SASI_Hs01_00141357 predicted 108
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078182 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359903 predicted 418
2 SASI_Rn02_00359904 predicted 579
3 SASI_Rn02_00359905 predicted 573
4 SASI_Rn02_00359906 predicted 575
5 SASI_Rn02_00359907 predicted 508
6 SASI_Rn02_00359908 predicted 408
7 SASI_Rn02_00359909 predicted 665
8 SASI_Rn02_00359910 predicted 597
9 SASI_Rn02_00359911 predicted 19
10 SASI_Rn02_00359912 predicted 168
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342101 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393744 predicted 414
2 SASI_Rn02_00393745 predicted 576
3 SASI_Rn02_00393746 predicted 571
4 SASI_Rn02_00393747 predicted 575
5 SASI_Rn02_00393748 predicted 506
6 SASI_Rn02_00393749 predicted 408
7 SASI_Rn02_00393750 predicted 664
8 SASI_Rn02_00393751 predicted 603
9 SASI_Rn02_00393752 predicted 22
10 SASI_Rn02_00393753 predicted 166
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011432 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020248 predicted 324
2 SASI_Mm02_00320655 predicted 467
3 SASI_Mm02_00320656 predicted 466
4 SASI_Mm02_00320657 predicted 469
5 SASI_Mm01_00020246 predicted 258
6 SASI_Mm01_00020255 predicted 402
7 SASI_Mm02_00320658 predicted 468
8 SASI_Mm02_00320659 predicted 223
9 SASI_Mm02_00320660 predicted 371
10 SASI_Mm01_00020249 predicted 534
11 SASI_Mm01_00020247 predicted 335
12 SASI_Mm01_00020250 predicted 529
13 SASI_Mm01_00020251 predicted 497
14 SASI_Mm01_00020252 predicted 444
15 SASI_Mm01_00020253 predicted 488
16 SASI_Mm01_00020254 predicted 529
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003093
VALIDATED
SNRPC MISSION shRNA Bacterial Glycerol Stock
small nuclear ribonucleoprotein polypeptide C
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003093.1-484s21c1
Sequence:CCGGCCAGACAGATAAGGATAGAGGCTCGAGCCTCTATCCTTATCTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003093.1-181s21c1
Sequence:CCGGGCATTTCAACAAGGAAAGATACTCGAGTATCTTTCCTTGTTGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306839    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003093.1-506s21c1
Sequence:CCGGGAGGCCTTATTGTATCGGTTTCTCGAGAAACCGATACAATAAGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_003093.1-67s21c1
Sequence:CCGGCCATCTGTGAGAAAGACACACCTCGAGGTGTGTCTTTCTCACAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003093.1-506s1c1
Sequence:CCGGGAGGCCTTATTGTATCGGTTTCTCGAGAAACCGATACAATAAGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003093.1-181s1c1
Sequence:CCGGGCATTTCAACAAGGAAAGATACTCGAGTATCTTTCCTTGTTGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003093.1-93s1c1
Sequence:CCGGTGGAAGGAAACACAAAGAGAACTCGAGTTCTCTTTGTGTTTCCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003093.1-470s1c1
Sequence:CCGGCCGGAATGACTCGACCAGACACTCGAGTGTCTGGTCGAGTCATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003093.1-176s1c1
Sequence:CCGGCGGCTGCATTTCAACAAGGAACTCGAGTTCCTTGTTGAAATGCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003093
VALIDATED
SNRPC MISSION shRNA shRNA Plasmid DNA
small nuclear ribonucleoprotein polypeptide C
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003093.1-484s21c1
Sequence:CCGGCCAGACAGATAAGGATAGAGGCTCGAGCCTCTATCCTTATCTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003093.1-181s21c1
Sequence:CCGGGCATTTCAACAAGGAAAGATACTCGAGTATCTTTCCTTGTTGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306839    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003093.1-506s21c1
Sequence:CCGGGAGGCCTTATTGTATCGGTTTCTCGAGAAACCGATACAATAAGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_003093.1-67s21c1
Sequence:CCGGCCATCTGTGAGAAAGACACACCTCGAGGTGTGTCTTTCTCACAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003093.1-506s1c1
Sequence:CCGGGAGGCCTTATTGTATCGGTTTCTCGAGAAACCGATACAATAAGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003093.1-181s1c1
Sequence:CCGGGCATTTCAACAAGGAAAGATACTCGAGTATCTTTCCTTGTTGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003093.1-93s1c1
Sequence:CCGGTGGAAGGAAACACAAAGAGAACTCGAGTTCTCTTTGTGTTTCCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003093.1-470s1c1
Sequence:CCGGCCGGAATGACTCGACCAGACACTCGAGTGTCTGGTCGAGTCATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003093.1-176s1c1
Sequence:CCGGCGGCTGCATTTCAACAAGGAACTCGAGTTCCTTGTTGAAATGCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003093
VALIDATED
SNRPC MISSION shRNA Lentiviral Transduction Particles
small nuclear ribonucleoprotein polypeptide C
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003093.1-484s21c1
Sequence:CCGGCCAGACAGATAAGGATAGAGGCTCGAGCCTCTATCCTTATCTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003093.1-181s21c1
Sequence:CCGGGCATTTCAACAAGGAAAGATACTCGAGTATCTTTCCTTGTTGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306839    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003093.1-506s21c1
Sequence:CCGGGAGGCCTTATTGTATCGGTTTCTCGAGAAACCGATACAATAAGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_003093.1-67s21c1
Sequence:CCGGCCATCTGTGAGAAAGACACACCTCGAGGTGTGTCTTTCTCACAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003093.1-506s1c1
Sequence:CCGGGAGGCCTTATTGTATCGGTTTCTCGAGAAACCGATACAATAAGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003093.1-181s1c1
Sequence:CCGGGCATTTCAACAAGGAAAGATACTCGAGTATCTTTCCTTGTTGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003093.1-93s1c1
Sequence:CCGGTGGAAGGAAACACAAAGAGAACTCGAGTTCTCTTTGTGTTTCCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003093.1-470s1c1
Sequence:CCGGCCGGAATGACTCGACCAGACACTCGAGTGTCTGGTCGAGTCATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003093.1-176s1c1
Sequence:CCGGCGGCTGCATTTCAACAAGGAACTCGAGTTCCTTGTTGAAATGCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011432
VALIDATED
SNRPC MISSION shRNA Bacterial Glycerol Stock
small nuclear ribonucleoprotein polypeptide C
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000287155    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011432.2-623s21c1
Sequence:CCGGCCGAGTGTTTACTAGATGCATCTCGAGATGCATCTAGTAAACACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011432.2-105s21c1
Sequence:CCGGTACGTATCTTACCCACGATTCCTCGAGGAATCGTGGGTAAGATACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011432.2-144s21c1
Sequence:CCGGACACTGCAGTGGTCGGAAACACTCGAGTGTTTCCGACCACTGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011432.2-170s21c1
Sequence:CCGGAGAATGTGAAAGACTATTATCCTCGAGGATAATAGTCTTTCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011432.2-226s21c1
Sequence:CCGGGACAAGACAACGGCTGCATTTCTCGAGAAATGCAGCCGTTGTCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011432.1-592s1c1
Sequence:CCGGCCGAGTGTTTACTAGATGCATCTCGAGATGCATCTAGTAAACACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011432.1-128s1c1
Sequence:CCGGGAAACACAAAGAGAATGTGAACTCGAGTTCACATTCTCTTTGTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011432.1-89s1c1
Sequence:CCGGCGATTCTCCATCTGTGAGGAACTCGAGTTCCTCACAGATGGAGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011432.1-184s1c1
Sequence:CCGGAGAGCCTGATTGACAAGACAACTCGAGTTGTCTTGTCAATCAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011432.1-341s1c1
Sequence:CCGGCCCTCCCATGATGCCAATGATCTCGAGATCATTGGCATCATGGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011432
VALIDATED
SNRPC MISSION shRNA shRNA Plasmid DNA
small nuclear ribonucleoprotein polypeptide C
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000287155    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011432.2-623s21c1
Sequence:CCGGCCGAGTGTTTACTAGATGCATCTCGAGATGCATCTAGTAAACACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011432.2-105s21c1
Sequence:CCGGTACGTATCTTACCCACGATTCCTCGAGGAATCGTGGGTAAGATACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011432.2-144s21c1
Sequence:CCGGACACTGCAGTGGTCGGAAACACTCGAGTGTTTCCGACCACTGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011432.2-170s21c1
Sequence:CCGGAGAATGTGAAAGACTATTATCCTCGAGGATAATAGTCTTTCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011432.2-226s21c1
Sequence:CCGGGACAAGACAACGGCTGCATTTCTCGAGAAATGCAGCCGTTGTCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011432.1-592s1c1
Sequence:CCGGCCGAGTGTTTACTAGATGCATCTCGAGATGCATCTAGTAAACACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011432.1-128s1c1
Sequence:CCGGGAAACACAAAGAGAATGTGAACTCGAGTTCACATTCTCTTTGTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011432.1-89s1c1
Sequence:CCGGCGATTCTCCATCTGTGAGGAACTCGAGTTCCTCACAGATGGAGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011432.1-184s1c1
Sequence:CCGGAGAGCCTGATTGACAAGACAACTCGAGTTGTCTTGTCAATCAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011432.1-341s1c1
Sequence:CCGGCCCTCCCATGATGCCAATGATCTCGAGATCATTGGCATCATGGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011432
VALIDATED
SNRPC MISSION shRNA Lentiviral Transduction Particles
small nuclear ribonucleoprotein polypeptide C
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000287155    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011432.2-623s21c1
Sequence:CCGGCCGAGTGTTTACTAGATGCATCTCGAGATGCATCTAGTAAACACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011432.2-105s21c1
Sequence:CCGGTACGTATCTTACCCACGATTCCTCGAGGAATCGTGGGTAAGATACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011432.2-144s21c1
Sequence:CCGGACACTGCAGTGGTCGGAAACACTCGAGTGTTTCCGACCACTGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011432.2-170s21c1
Sequence:CCGGAGAATGTGAAAGACTATTATCCTCGAGGATAATAGTCTTTCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011432.2-226s21c1
Sequence:CCGGGACAAGACAACGGCTGCATTTCTCGAGAAATGCAGCCGTTGTCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011432.1-592s1c1
Sequence:CCGGCCGAGTGTTTACTAGATGCATCTCGAGATGCATCTAGTAAACACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011432.1-128s1c1
Sequence:CCGGGAAACACAAAGAGAATGTGAACTCGAGTTCACATTCTCTTTGTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011432.1-89s1c1
Sequence:CCGGCGATTCTCCATCTGTGAGGAACTCGAGTTCCTCACAGATGGAGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011432.1-184s1c1
Sequence:CCGGAGAGCCTGATTGACAAGACAACTCGAGTTGTCTTGTCAATCAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011432.1-341s1c1
Sequence:CCGGCCCTCCCATGATGCCAATGATCTCGAGATCATTGGCATCATGGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks