EMAIL THIS PAGE TO A FRIEND

SNRPG

small nuclear ribonucleoprotein polypeptide G

Synonyms: SMG Sm-G
UniProtKB ID: P62308, D6W5G6, Q15357, Q6IB86
Gene ID:
Mouse(68011) small nuclear ribonucleoprotein polypeptide G
Rat(681031) small nuclear ribonucleoprotein polypeptide G
domestic cat(101096882) small nuclear ribonucleoprotein polypeptide G
dog(612653) small nuclear ribonucleoprotein polypeptide G
cow(522621) small nuclear ribonucleoprotein polypeptide G
naked mole-rat(101724662) small nuclear ribonucleoprotein polypeptide G
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003096 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003096 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003096 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026506 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026506 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026506 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU202341 MISSION® esiRNA esiRNA targeting mouse Snrpg mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003096 Rosetta Predictions human pricing
NM_026506 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003096 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335051 predicted 446
2 SASI_Hs02_00335052 predicted 521
3 SASI_Hs02_00335053 predicted 453
4 SASI_Hs02_00335054 predicted 451
5 SASI_Hs01_00156248 predicted 272
6 SASI_Hs01_00156249 predicted 277
7 SASI_Hs01_00156250 predicted 235
8 SASI_Hs01_00156251 predicted 264
9 SASI_Hs01_00156252 predicted 237
10 SASI_Hs01_00156253 predicted 306
11 SASI_Hs01_00156254 predicted 337
12 SASI_Hs01_00156255 predicted 265
13 SASI_Hs01_00156256 predicted 274
14 SASI_Hs01_00156257 predicted 300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026506 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134580 predicted 270
2 SASI_Mm01_00134582 predicted 225
3 SASI_Mm01_00134583 predicted 312
4 SASI_Mm01_00134584 predicted 227
5 SASI_Mm01_00134587 predicted 237
6 SASI_Mm02_00330408 predicted 311
7 SASI_Mm02_00330409 predicted 246
8 SASI_Mm02_00330410 predicted 220
9 SASI_Mm02_00330411 predicted 326
10 SASI_Mm02_00330412 predicted 216
11 SASI_Mm01_00134581 predicted 185
12 SASI_Mm01_00134585 predicted 93
13 SASI_Mm01_00134586 predicted 163
14 SASI_Mm01_00134588 predicted 146
15 SASI_Mm01_00134589 predicted 83
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003096
SNRPG MISSION shRNA Bacterial Glycerol Stock
small nuclear ribonucleoprotein polypeptide G
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003096.2-451s1c1
Sequence:CCGGGCTTTCTCAGATGTTCTGAATCTCGAGATTCAGAACATCTGAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003096.2-239s1c1
Sequence:CCGGAGTGGACAACAGAACAATATTCTCGAGAATATTGTTCTGTTGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003096.2-211s1c1
Sequence:CCGGGATAGATGAATGTGTGGAGATCTCGAGATCTCCACACATTCATCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003096.2-264s1c1
Sequence:CCGGTGGTGGTAATACGAGGAAATACTCGAGTATTTCCTCGTATTACCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003096.2-194s1c1
Sequence:CCGGCCCTTTATGAACCTTGTGATACTCGAGTATCACAAGGTTCATAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003096.2-253s21c1
Sequence:CCGGCAATATTGGAATGGTGGTAATCTCGAGATTACCACCATTCCAATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003096.2-125s21c1
Sequence:CCGGATGGACAAGAAGTTATCATTGCTCGAGCAATGATAACTTCTTGTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003096.2-279s21c1
Sequence:CCGGGAAATAGTATCATCATGTTAGCTCGAGCTAACATGATGATACTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003096.2-161s21c1
Sequence:CCGGAGACATGTCCAAGGAATATTGCTCGAGCAATATTCCTTGGACATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003096.2-298s21c1
Sequence:CCGGAGAAGCCTTGGAACGAGTATACTCGAGTATACTCGTTCCAAGGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003096
SNRPG MISSION shRNA shRNA Plasmid DNA
small nuclear ribonucleoprotein polypeptide G
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003096.2-451s1c1
Sequence:CCGGGCTTTCTCAGATGTTCTGAATCTCGAGATTCAGAACATCTGAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003096.2-239s1c1
Sequence:CCGGAGTGGACAACAGAACAATATTCTCGAGAATATTGTTCTGTTGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003096.2-211s1c1
Sequence:CCGGGATAGATGAATGTGTGGAGATCTCGAGATCTCCACACATTCATCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003096.2-264s1c1
Sequence:CCGGTGGTGGTAATACGAGGAAATACTCGAGTATTTCCTCGTATTACCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003096.2-194s1c1
Sequence:CCGGCCCTTTATGAACCTTGTGATACTCGAGTATCACAAGGTTCATAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003096.2-253s21c1
Sequence:CCGGCAATATTGGAATGGTGGTAATCTCGAGATTACCACCATTCCAATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003096.2-125s21c1
Sequence:CCGGATGGACAAGAAGTTATCATTGCTCGAGCAATGATAACTTCTTGTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003096.2-279s21c1
Sequence:CCGGGAAATAGTATCATCATGTTAGCTCGAGCTAACATGATGATACTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003096.2-161s21c1
Sequence:CCGGAGACATGTCCAAGGAATATTGCTCGAGCAATATTCCTTGGACATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003096.2-298s21c1
Sequence:CCGGAGAAGCCTTGGAACGAGTATACTCGAGTATACTCGTTCCAAGGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003096
SNRPG MISSION shRNA Lentiviral Transduction Particles
small nuclear ribonucleoprotein polypeptide G
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003096.2-451s1c1
Sequence:CCGGGCTTTCTCAGATGTTCTGAATCTCGAGATTCAGAACATCTGAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003096.2-239s1c1
Sequence:CCGGAGTGGACAACAGAACAATATTCTCGAGAATATTGTTCTGTTGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003096.2-211s1c1
Sequence:CCGGGATAGATGAATGTGTGGAGATCTCGAGATCTCCACACATTCATCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003096.2-264s1c1
Sequence:CCGGTGGTGGTAATACGAGGAAATACTCGAGTATTTCCTCGTATTACCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003096.2-194s1c1
Sequence:CCGGCCCTTTATGAACCTTGTGATACTCGAGTATCACAAGGTTCATAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003096.2-253s21c1
Sequence:CCGGCAATATTGGAATGGTGGTAATCTCGAGATTACCACCATTCCAATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003096.2-125s21c1
Sequence:CCGGATGGACAAGAAGTTATCATTGCTCGAGCAATGATAACTTCTTGTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003096.2-279s21c1
Sequence:CCGGGAAATAGTATCATCATGTTAGCTCGAGCTAACATGATGATACTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003096.2-161s21c1
Sequence:CCGGAGACATGTCCAAGGAATATTGCTCGAGCAATATTCCTTGGACATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003096.2-298s21c1
Sequence:CCGGAGAAGCCTTGGAACGAGTATACTCGAGTATACTCGTTCCAAGGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026506
VALIDATED
SNRPG MISSION shRNA Bacterial Glycerol Stock
small nuclear ribonucleoprotein polypeptide G
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026506.1-230s1c1
Sequence:CCGGCCGAGGAAACAGCATCATCATCTCGAGATGATGATGCTGTTTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026506.1-203s1c1
Sequence:CCGGACAGAACAACATTGGCATGGTCTCGAGACCATGCCAATGTTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026506.1-150s1c1
Sequence:CCGGCCCTTTATGAACCTTGTGATTCTCGAGAATCACAAGGTTCATAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026506.1-213s1c1
Sequence:CCGGATTGGCATGGTGGTCATCCGACTCGAGTCGGATGACCACCATGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026506.1-71s1c1
Sequence:CCGGGAAGAAGTTTATGGACAAGAACTCGAGTTCTTGTCCATAAACTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026506.2-149s21c1
Sequence:CCGGCCCTTTATGAACCTTGTGATTCTCGAGAATCACAAGGTTCATAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026506.2-229s21c1
Sequence:CCGGCCGAGGAAACAGCATCATCATCTCGAGATGATGATGCTGTTTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026506.2-82s21c1
Sequence:CCGGGGACAAGAAGTTATCATTGAACTCGAGTTCAATGATAACTTCTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026506.2-168s21c1
Sequence:CCGGTTGACGAGTGTGTGGAGATGGCTCGAGCCATCTCCACACACTCGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026506
VALIDATED
SNRPG MISSION shRNA shRNA Plasmid DNA
small nuclear ribonucleoprotein polypeptide G
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026506.1-230s1c1
Sequence:CCGGCCGAGGAAACAGCATCATCATCTCGAGATGATGATGCTGTTTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026506.1-203s1c1
Sequence:CCGGACAGAACAACATTGGCATGGTCTCGAGACCATGCCAATGTTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026506.1-150s1c1
Sequence:CCGGCCCTTTATGAACCTTGTGATTCTCGAGAATCACAAGGTTCATAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026506.1-213s1c1
Sequence:CCGGATTGGCATGGTGGTCATCCGACTCGAGTCGGATGACCACCATGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026506.1-71s1c1
Sequence:CCGGGAAGAAGTTTATGGACAAGAACTCGAGTTCTTGTCCATAAACTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026506.2-149s21c1
Sequence:CCGGCCCTTTATGAACCTTGTGATTCTCGAGAATCACAAGGTTCATAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026506.2-229s21c1
Sequence:CCGGCCGAGGAAACAGCATCATCATCTCGAGATGATGATGCTGTTTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026506.2-82s21c1
Sequence:CCGGGGACAAGAAGTTATCATTGAACTCGAGTTCAATGATAACTTCTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026506.2-168s21c1
Sequence:CCGGTTGACGAGTGTGTGGAGATGGCTCGAGCCATCTCCACACACTCGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026506
VALIDATED
SNRPG MISSION shRNA Lentiviral Transduction Particles
small nuclear ribonucleoprotein polypeptide G
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026506.1-230s1c1
Sequence:CCGGCCGAGGAAACAGCATCATCATCTCGAGATGATGATGCTGTTTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026506.1-203s1c1
Sequence:CCGGACAGAACAACATTGGCATGGTCTCGAGACCATGCCAATGTTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026506.1-150s1c1
Sequence:CCGGCCCTTTATGAACCTTGTGATTCTCGAGAATCACAAGGTTCATAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026506.1-213s1c1
Sequence:CCGGATTGGCATGGTGGTCATCCGACTCGAGTCGGATGACCACCATGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026506.1-71s1c1
Sequence:CCGGGAAGAAGTTTATGGACAAGAACTCGAGTTCTTGTCCATAAACTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026506.2-149s21c1
Sequence:CCGGCCCTTTATGAACCTTGTGATTCTCGAGAATCACAAGGTTCATAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026506.2-229s21c1
Sequence:CCGGCCGAGGAAACAGCATCATCATCTCGAGATGATGATGCTGTTTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026506.2-82s21c1
Sequence:CCGGGGACAAGAAGTTATCATTGAACTCGAGTTCAATGATAACTTCTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026506.2-168s21c1
Sequence:CCGGTTGACGAGTGTGTGGAGATGGCTCGAGCCATCTCCACACACTCGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks