EMAIL THIS PAGE TO A FRIEND

SNRPN

small nuclear ribonucleoprotein polypeptide N

Synonyms: HCERN3 PWCR RT-LI SM-D SMN SNRNP-N SNURF-SNRPN sm-N
UniProtKB ID: P63162, P14648, P17135, Q0D2Q5
Gene ID:
Human(6638) Summary: The protein encoded by this gene is one polypeptide of a small nuclear ribonucleoprotein complex and belongs to the snRNP SMB/SMN family. The protein plays a role in pre-mRNA processing, possibly tissue-specific alternative splicing events. Although individual snRNPs are believed to recognize specific nucleic acid sequences through RNA-RNA base pairing, the specific role of this family member is unknown. The protein arises from a bicistronic transcript that also encodes a protein identified as the SNRPN upstream reading frame (SNURF). Multiple transcription initiation sites have been identified and extensive alternative splicing occurs in the 5' untranslated region. Additional splice variants have been described but sequences for the complete transcripts have not been determined. The 5' UTR of this gene has been identified as an imprinting center. Alternative splicing or deletion caused by a translocation event in this paternally-expressed region is responsible for Angelman syndrome or Prader-Willi syndrome due to parental imprint switch failure. [provided by RefSeq, Jul 2008]
Mouse(20646) small nuclear ribonucleoprotein N
Rat(81781) small nuclear ribonucleoprotein polypeptide N
dog(479012) small nuclear ribonucleoprotein polypeptide N
domestic cat(101089444) small nuclear ribonucleoprotein polypeptide N
domestic guinea pig(100730238) small nuclear ribonucleoprotein polypeptide N
cow(780877) small nuclear ribonucleoprotein polypeptide N
325 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003097 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003097 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003097 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013670 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013670 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013670 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003097 Rosetta Predictions human pricing
NM_022805 Rosetta Predictions human pricing
NM_022806 Rosetta Predictions human pricing
NM_022807 Rosetta Predictions human pricing
NM_022808 Rosetta Predictions human pricing
NM_031117 Rosetta Predictions rat pricing
NM_001082961 Rosetta Predictions mouse pricing
NM_001082962 Rosetta Predictions mouse pricing
NM_013670 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003097 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237995 predicted 729
2 SASI_Hs01_00237996 predicted 617
3 SASI_Hs01_00237997 predicted 490
4 SASI_Hs01_00237998 predicted 631
5 SASI_Hs02_00335055 predicted 635
6 SASI_Hs01_00237999 predicted 681
7 SASI_Hs01_00238000 predicted 885
8 SASI_Hs01_00238001 predicted 870
9 SASI_Hs01_00238003 predicted 798
10 SASI_Hs01_00238004 predicted 495
11 SASI_Hs01_00238002 predicted 748
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022805 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099701 predicted 1008
2 SASI_Hs01_00099702 predicted 897
3 SASI_Hs01_00099703 predicted 768
4 SASI_Hs01_00099704 predicted 911
5 SASI_Hs02_00356104 predicted 908
6 SASI_Hs01_00099705 predicted 958
7 SASI_Hs01_00099706 predicted 1160
8 SASI_Hs01_00099707 predicted 1145
9 SASI_Hs01_00099709 predicted 1077
10 SASI_Hs01_00099710 predicted 768
11 SASI_Hs01_00099708 predicted 1023
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022806 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044814 predicted 1019
2 SASI_Hs01_00044815 predicted 909
3 SASI_Hs01_00044816 predicted 787
4 SASI_Hs01_00044817 predicted 919
5 SASI_Hs02_00356105 predicted 920
6 SASI_Hs01_00044818 predicted 969
7 SASI_Hs01_00044819 predicted 1166
8 SASI_Hs01_00044820 predicted 1158
9 SASI_Hs01_00044822 predicted 1092
10 SASI_Hs01_00044823 predicted 782
11 SASI_Hs01_00044821 predicted 1041
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022807 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174826 predicted 1157
2 SASI_Hs01_00174827 predicted 1038
3 SASI_Hs01_00174828 predicted 923
4 SASI_Hs01_00174829 predicted 1051
5 SASI_Hs02_00356106 predicted 1060
6 SASI_Hs01_00174830 predicted 1106
7 SASI_Hs01_00174831 predicted 1307
8 SASI_Hs01_00174832 predicted 1288
9 SASI_Hs01_00174834 predicted 1225
10 SASI_Hs01_00174835 predicted 915
11 SASI_Hs01_00174833 predicted 1167
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022808 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137381 predicted 1044
2 SASI_Hs01_00137382 predicted 937
3 SASI_Hs01_00137383 predicted 812
4 SASI_Hs01_00137384 predicted 945
5 SASI_Hs02_00356107 predicted 943
6 SASI_Hs01_00137385 predicted 1003
7 SASI_Hs01_00137386 predicted 1200
8 SASI_Hs01_00137387 predicted 1183
9 SASI_Hs01_00137389 predicted 1118
10 SASI_Hs01_00137390 predicted 807
11 SASI_Hs01_00137388 predicted 1066
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031117 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105913 predicted 629
2 SASI_Rn01_00105914 predicted 671
3 SASI_Rn02_00264422 predicted 664
4 SASI_Rn01_00105915 predicted 604
5 SASI_Rn01_00105916 predicted 664
6 SASI_Rn01_00105917 predicted 620
7 SASI_Rn01_00105919 predicted 858
8 SASI_Rn01_00105920 predicted 608
9 SASI_Rn01_00105921 predicted 606
10 SASI_Rn01_00105922 predicted 814
11 SASI_Rn01_00105918 predicted 1188
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082961 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299395 predicted 1560
2 SASI_Mm02_00299396 predicted 786
3 SASI_Mm02_00299397 predicted 1468
4 SASI_Mm02_00299398 predicted 640
5 SASI_Mm02_00299399 predicted 1477
6 SASI_Mm02_00299400 predicted 1552
7 SASI_Mm02_00299401 predicted 794
8 SASI_Mm02_00299402 predicted 1564
9 SASI_Mm02_00299403 predicted 1541
10 SASI_Mm02_00299404 predicted 1377
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082962 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299405 predicted 1600
2 SASI_Mm02_00299406 predicted 836
3 SASI_Mm02_00299407 predicted 1518
4 SASI_Mm02_00299408 predicted 681
5 SASI_Mm02_00299409 predicted 1521
6 SASI_Mm02_00299410 predicted 1596
7 SASI_Mm02_00299411 predicted 834
8 SASI_Mm02_00299412 predicted 1609
9 SASI_Mm02_00299413 predicted 1585
10 SASI_Mm02_00299414 predicted 1420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013670 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322505 predicted 1496
2 SASI_Mm01_00178077 predicted 729
3 SASI_Mm02_00322506 predicted 1403
4 SASI_Mm01_00178078 predicted 577
5 SASI_Mm02_00322507 predicted 1420
6 SASI_Mm02_00322508 predicted 1490
7 SASI_Mm01_00178079 predicted 730
8 SASI_Mm02_00322509 predicted 1500
9 SASI_Mm02_00322510 predicted 1479
10 SASI_Mm02_00322511 predicted 1317
11 SASI_Mm01_00178075 predicted 575
12 SASI_Mm01_00178076 predicted 530
13 SASI_Mm01_00178080 predicted 727
14 SASI_Mm01_00178081 predicted 539
15 SASI_Mm01_00178082 predicted 570
16 SASI_Mm01_00178083 predicted 507
17 SASI_Mm01_00178084 predicted 836
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003097
SNRPN MISSION shRNA Bacterial Glycerol Stock
small nuclear ribonucleoprotein polypeptide N
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003097.3-872s21c1
Sequence:CCGGGACCATCCCAGCAGGTAATGACTCGAGTCATTACCTGCTGGGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003097.3-929s21c1
Sequence:CCGGTTGCTGCGACTGCCAGTATTGCTCGAGCAATACTGGCAGTCGCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003097.3-491s21c1
Sequence:CCGGTGCTGCAGCACATTGACTATACTCGAGTATAGTCAATGTGCTGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003097.3-633s21c1
Sequence:CCGGGAAGCAACCAGAGCGTGAAGACTCGAGTCTTCACGCTCTGGTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003097.3-538s1c1
Sequence:CCGGCGAATCTTCATTGGCACCTTTCTCGAGAAAGGTGCCAATGAAGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003097.3-606s1c1
Sequence:CCGGGTTCAGAAAGATCAAGCCAAACTCGAGTTTGGCTTGATCTTTCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003097.3-609s1c1
Sequence:CCGGCAGAAAGATCAAGCCAAAGAACTCGAGTTCTTTGGCTTGATCTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003097.3-539s1c1
Sequence:CCGGGAATCTTCATTGGCACCTTTACTCGAGTAAAGGTGCCAATGAAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003097.3-588s1c1
Sequence:CCGGCCTCTGTGATTGTGATGAGTTCTCGAGAACTCATCACAATCACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003097
SNRPN MISSION shRNA shRNA Plasmid DNA
small nuclear ribonucleoprotein polypeptide N
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003097.3-872s21c1
Sequence:CCGGGACCATCCCAGCAGGTAATGACTCGAGTCATTACCTGCTGGGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003097.3-929s21c1
Sequence:CCGGTTGCTGCGACTGCCAGTATTGCTCGAGCAATACTGGCAGTCGCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003097.3-491s21c1
Sequence:CCGGTGCTGCAGCACATTGACTATACTCGAGTATAGTCAATGTGCTGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003097.3-633s21c1
Sequence:CCGGGAAGCAACCAGAGCGTGAAGACTCGAGTCTTCACGCTCTGGTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003097.3-538s1c1
Sequence:CCGGCGAATCTTCATTGGCACCTTTCTCGAGAAAGGTGCCAATGAAGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003097.3-606s1c1
Sequence:CCGGGTTCAGAAAGATCAAGCCAAACTCGAGTTTGGCTTGATCTTTCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003097.3-609s1c1
Sequence:CCGGCAGAAAGATCAAGCCAAAGAACTCGAGTTCTTTGGCTTGATCTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003097.3-539s1c1
Sequence:CCGGGAATCTTCATTGGCACCTTTACTCGAGTAAAGGTGCCAATGAAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003097.3-588s1c1
Sequence:CCGGCCTCTGTGATTGTGATGAGTTCTCGAGAACTCATCACAATCACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003097
SNRPN MISSION shRNA Lentiviral Transduction Particles
small nuclear ribonucleoprotein polypeptide N
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003097.3-872s21c1
Sequence:CCGGGACCATCCCAGCAGGTAATGACTCGAGTCATTACCTGCTGGGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003097.3-929s21c1
Sequence:CCGGTTGCTGCGACTGCCAGTATTGCTCGAGCAATACTGGCAGTCGCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003097.3-491s21c1
Sequence:CCGGTGCTGCAGCACATTGACTATACTCGAGTATAGTCAATGTGCTGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003097.3-633s21c1
Sequence:CCGGGAAGCAACCAGAGCGTGAAGACTCGAGTCTTCACGCTCTGGTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003097.3-538s1c1
Sequence:CCGGCGAATCTTCATTGGCACCTTTCTCGAGAAAGGTGCCAATGAAGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003097.3-606s1c1
Sequence:CCGGGTTCAGAAAGATCAAGCCAAACTCGAGTTTGGCTTGATCTTTCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003097.3-609s1c1
Sequence:CCGGCAGAAAGATCAAGCCAAAGAACTCGAGTTCTTTGGCTTGATCTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003097.3-539s1c1
Sequence:CCGGGAATCTTCATTGGCACCTTTACTCGAGTAAAGGTGCCAATGAAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003097.3-588s1c1
Sequence:CCGGCCTCTGTGATTGTGATGAGTTCTCGAGAACTCATCACAATCACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013670
SNRPN MISSION shRNA Bacterial Glycerol Stock
small nuclear ribonucleoprotein polypeptide N
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013670.2-713s1c1
Sequence:CCGGCCTCCTAAAGATACTGGCATTCTCGAGAATGCCAGTATCTTTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013670.2-520s1c1
Sequence:CCGGGCAAGATGGGAGAATCTTCATCTCGAGATGAAGATTCTCCCATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013670.2-601s1c1
Sequence:CCGGCAGGAAGATCAAGCCAAAGAACTCGAGTTCTTTGGCTTGATCTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013670.2-598s1c1
Sequence:CCGGGTTCAGGAAGATCAAGCCAAACTCGAGTTTGGCTTGATCTTCCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013670.2-517s1c1
Sequence:CCGGCCTGCAAGATGGGAGAATCTTCTCGAGAAGATTCTCCCATCTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013670
SNRPN MISSION shRNA shRNA Plasmid DNA
small nuclear ribonucleoprotein polypeptide N
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013670.2-713s1c1
Sequence:CCGGCCTCCTAAAGATACTGGCATTCTCGAGAATGCCAGTATCTTTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013670.2-520s1c1
Sequence:CCGGGCAAGATGGGAGAATCTTCATCTCGAGATGAAGATTCTCCCATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013670.2-601s1c1
Sequence:CCGGCAGGAAGATCAAGCCAAAGAACTCGAGTTCTTTGGCTTGATCTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013670.2-598s1c1
Sequence:CCGGGTTCAGGAAGATCAAGCCAAACTCGAGTTTGGCTTGATCTTCCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013670.2-517s1c1
Sequence:CCGGCCTGCAAGATGGGAGAATCTTCTCGAGAAGATTCTCCCATCTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013670
SNRPN MISSION shRNA Lentiviral Transduction Particles
small nuclear ribonucleoprotein polypeptide N
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013670.2-713s1c1
Sequence:CCGGCCTCCTAAAGATACTGGCATTCTCGAGAATGCCAGTATCTTTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013670.2-520s1c1
Sequence:CCGGGCAAGATGGGAGAATCTTCATCTCGAGATGAAGATTCTCCCATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013670.2-601s1c1
Sequence:CCGGCAGGAAGATCAAGCCAAAGAACTCGAGTTCTTTGGCTTGATCTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013670.2-598s1c1
Sequence:CCGGGTTCAGGAAGATCAAGCCAAACTCGAGTTTGGCTTGATCTTCCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013670.2-517s1c1
Sequence:CCGGCCTGCAAGATGGGAGAATCTTCTCGAGAAGATTCTCCCATCTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks