EMAIL THIS PAGE TO A FRIEND

SNTA1

syntrophin, alpha 1

Synonyms: LQT12 SNT1 TACIP1 dJ1187J4.5
UniProtKB ID: Q13424, A8K7H9, E1P5N1, Q16438
Gene ID:
Human(6640) Summary: Syntrophins are cytoplasmic peripheral membrane scaffold proteins that are components of the dystrophin-associated protein complex. This gene is a member of the syntrophin gene family and encodes the most common syntrophin isoform found in cardiac tissues. The N-terminal PDZ domain of this syntrophin protein interacts with the C-terminus of the pore-forming alpha subunit (SCN5A) of the cardiac sodium channel Nav1.5. This protein also associates cardiac sodium channels with the nitric oxide synthase-PMCA4b (plasma membrane Ca-ATPase subtype 4b) complex in cardiomyocytes. This gene is a susceptibility locus for Long-QT syndrome (LQT) - an inherited disorder associated with sudden cardiac death from arrhythmia - and sudden infant death syndrome (SIDS). This protein also associates with dystrophin and dystrophin-related proteins at the neuromuscular junction and alters intracellular calcium ion levels in muscle tissue. [provided by RefSeq, Jan 2013]
Mouse(20648) syntrophin, acidic 1
Rat(362242) syntrophin, alpha 1
domestic cat(101098944) syntrophin, alpha 1
dog(485837) syntrophin, alpha 1
cow(527488) syntrophin, alpha 1 (dystrophin-associated protein A1, 59kDa, acidic component)
sheep(101109469) syntrophin, alpha 1
domestic guinea pig(100732931) syntrophin, alpha 1
naked mole-rat(101721241) syntrophin, alpha 1
Domestic Rabbit(100009179) syntrophin, alpha 1
86 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
S4688 Anti-α1-Syntrophin (AG-17) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution rat
immunohistochemistry, microarray, western blot pricing
S4813 Anti-α1-Syntrophin (RA-16) antibody produced in rabbit buffered aqueous solution, IgG fraction of antiserum rat
immunohistochemistry, microarray, western blot pricing
SAB2501011 Anti-Syntrophin α1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, rat, mouse
ELISA, western blot pricing
SAB4200213 Monoclonal Anti-Syntrophin antibody produced in mouse ~1.0 mg/mL, clone 1351, purified immunoglobulin human, rat, mouse, chicken, Xenopus, frog
electron microscopy, immunofluorescence, immunoprecipitation, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009228 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009228 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009228 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003098 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003098 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003098 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU056611 MISSION® esiRNA esiRNA human SNTA1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003098 Rosetta Predictions human pricing
NM_001100901 Rosetta Predictions rat pricing
NM_009228 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003098 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229005 predicted 775
2 SASI_Hs02_00335056 predicted 1608
3 SASI_Hs01_00229006 predicted 788
4 SASI_Hs01_00229007 predicted 1894
5 SASI_Hs01_00229008 predicted 774
6 SASI_Hs01_00229009 predicted 1532
7 SASI_Hs01_00229010 predicted 1614
8 SASI_Hs01_00229011 predicted 1335
9 SASI_Hs01_00229012 predicted 1497
10 SASI_Hs01_00229013 predicted 1220
11 SASI_Hs01_00229014 predicted 920
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100901 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210712 predicted 494
2 SASI_Rn02_00210713 predicted 1545
3 SASI_Rn02_00210714 predicted 1601
4 SASI_Rn02_00210715 predicted 467
5 SASI_Rn02_00210716 predicted 541
6 SASI_Rn02_00210717 predicted 719
7 SASI_Rn02_00210718 predicted 1348
8 SASI_Rn02_00210719 predicted 879
9 SASI_Rn02_00210720 predicted 575
10 SASI_Rn02_00210721 predicted 392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009228 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315675 predicted 1819
2 SASI_Mm01_00079544 predicted 573
3 SASI_Mm01_00079545 predicted 884
4 SASI_Mm01_00079546 predicted 553
5 SASI_Mm01_00079547 predicted 975
6 SASI_Mm01_00079548 predicted 1215
7 SASI_Mm01_00079549 predicted 560
8 SASI_Mm01_00079551 predicted 1310
9 SASI_Mm01_00079552 predicted 1431
10 SASI_Mm01_00079553 predicted 935
11 SASI_Mm01_00079550 predicted 1828
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009228
VALIDATED
SNTA1 MISSION shRNA Bacterial Glycerol Stock
syntrophin, alpha 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009228.1-899s1c1
Sequence:CCGGCACATTCATACCTTGGGTCAACTCGAGTTGACCCAAGGTATGAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009228.1-1448s1c1
Sequence:CCGGGCCCTTCGAGAAACTTCAGATCTCGAGATCTGAAGTTTCTCGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009228.1-898s1c1
Sequence:CCGGGCACATTCATACCTTGGGTCACTCGAGTGACCCAAGGTATGAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009228.1-1832s1c1
Sequence:CCGGGCCTTTCTAAGAGAGATATTTCTCGAGAAATATCTCTCTTAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009228.1-607s1c1
Sequence:CCGGTCTCACCCTATTTCAAGAATTCTCGAGAATTCTTGAAATAGGGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009228.2-503s21c1
Sequence:CCGGGTCTGTGAATGGTGAAGATTTCTCGAGAAATCTTCACCATTCACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009228.2-1554s21c1
Sequence:CCGGGTCTTTATCATCCACTCTTTCCTCGAGGAAAGAGTGGATGATAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009228.2-418s21c1
Sequence:CCGGACAAGATGCCTATTCTCATTTCTCGAGAAATGAGAATAGGCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009228.2-602s21c1
Sequence:CCGGGAAGGAGGTCTCACCCTATTTCTCGAGAAATAGGGTGAGACCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009228.2-892s21c1
Sequence:CCGGCGCAGATCGGCACATTCATACCTCGAGGTATGAATGTGCCGATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366974    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009228.2-1632s21c1
Sequence:CCGGGCCCTGAAGAGGATCGTTCATCTCGAGATGAACGATCCTCTTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009228
VALIDATED
SNTA1 MISSION shRNA shRNA Plasmid DNA
syntrophin, alpha 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009228.1-899s1c1
Sequence:CCGGCACATTCATACCTTGGGTCAACTCGAGTTGACCCAAGGTATGAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009228.1-1448s1c1
Sequence:CCGGGCCCTTCGAGAAACTTCAGATCTCGAGATCTGAAGTTTCTCGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009228.1-898s1c1
Sequence:CCGGGCACATTCATACCTTGGGTCACTCGAGTGACCCAAGGTATGAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009228.1-1832s1c1
Sequence:CCGGGCCTTTCTAAGAGAGATATTTCTCGAGAAATATCTCTCTTAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009228.1-607s1c1
Sequence:CCGGTCTCACCCTATTTCAAGAATTCTCGAGAATTCTTGAAATAGGGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009228.2-503s21c1
Sequence:CCGGGTCTGTGAATGGTGAAGATTTCTCGAGAAATCTTCACCATTCACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009228.2-1554s21c1
Sequence:CCGGGTCTTTATCATCCACTCTTTCCTCGAGGAAAGAGTGGATGATAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009228.2-418s21c1
Sequence:CCGGACAAGATGCCTATTCTCATTTCTCGAGAAATGAGAATAGGCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009228.2-602s21c1
Sequence:CCGGGAAGGAGGTCTCACCCTATTTCTCGAGAAATAGGGTGAGACCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009228.2-892s21c1
Sequence:CCGGCGCAGATCGGCACATTCATACCTCGAGGTATGAATGTGCCGATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366974    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009228.2-1632s21c1
Sequence:CCGGGCCCTGAAGAGGATCGTTCATCTCGAGATGAACGATCCTCTTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009228
VALIDATED
SNTA1 MISSION shRNA Lentiviral Transduction Particles
syntrophin, alpha 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009228.1-899s1c1
Sequence:CCGGCACATTCATACCTTGGGTCAACTCGAGTTGACCCAAGGTATGAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009228.1-1448s1c1
Sequence:CCGGGCCCTTCGAGAAACTTCAGATCTCGAGATCTGAAGTTTCTCGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009228.1-898s1c1
Sequence:CCGGGCACATTCATACCTTGGGTCACTCGAGTGACCCAAGGTATGAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009228.1-1832s1c1
Sequence:CCGGGCCTTTCTAAGAGAGATATTTCTCGAGAAATATCTCTCTTAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009228.1-607s1c1
Sequence:CCGGTCTCACCCTATTTCAAGAATTCTCGAGAATTCTTGAAATAGGGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009228.2-503s21c1
Sequence:CCGGGTCTGTGAATGGTGAAGATTTCTCGAGAAATCTTCACCATTCACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009228.2-1554s21c1
Sequence:CCGGGTCTTTATCATCCACTCTTTCCTCGAGGAAAGAGTGGATGATAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009228.2-418s21c1
Sequence:CCGGACAAGATGCCTATTCTCATTTCTCGAGAAATGAGAATAGGCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009228.2-602s21c1
Sequence:CCGGGAAGGAGGTCTCACCCTATTTCTCGAGAAATAGGGTGAGACCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009228.2-892s21c1
Sequence:CCGGCGCAGATCGGCACATTCATACCTCGAGGTATGAATGTGCCGATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366974    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009228.2-1632s21c1
Sequence:CCGGGCCCTGAAGAGGATCGTTCATCTCGAGATGAACGATCCTCTTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003098
VALIDATED
SNTA1 MISSION shRNA Bacterial Glycerol Stock
syntrophin, alpha 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003098.2-602s1c1
Sequence:CCGGGCCTATTCTCATTTCCAAGATCTCGAGATCTTGGAAATGAGAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003098.2-790s1c1
Sequence:CCGGCACCGTATTTCAAGAACTCTACTCGAGTAGAGTTCTTGAAATACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003098.2-587s1c1
Sequence:CCGGCCGGGAGAACAAGATGCCTATCTCGAGATAGGCATCTTGTTCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003098.2-761s1c1
Sequence:CCGGGCTGGAGGTCAAGTATATGAACTCGAGTTCATATACTTGACCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003098.2-1153s1c1
Sequence:CCGGTCAAGCAGATTGGCTGGCTAACTCGAGTTAGCCAGCCAATCTGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003098.2-602s21c1
Sequence:CCGGGCCTATTCTCATTTCCAAGATCTCGAGATCTTGGAAATGAGAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003098.2-587s21c1
Sequence:CCGGCCGGGAGAACAAGATGCCTATCTCGAGATAGGCATCTTGTTCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003098.2-761s21c1
Sequence:CCGGGCTGGAGGTCAAGTATATGAACTCGAGTTCATATACTTGACCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003098.2-790s21c1
Sequence:CCGGCACCGTATTTCAAGAACTCTACTCGAGTAGAGTTCTTGAAATACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003098
VALIDATED
SNTA1 MISSION shRNA shRNA Plasmid DNA
syntrophin, alpha 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003098.2-602s1c1
Sequence:CCGGGCCTATTCTCATTTCCAAGATCTCGAGATCTTGGAAATGAGAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003098.2-790s1c1
Sequence:CCGGCACCGTATTTCAAGAACTCTACTCGAGTAGAGTTCTTGAAATACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003098.2-587s1c1
Sequence:CCGGCCGGGAGAACAAGATGCCTATCTCGAGATAGGCATCTTGTTCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003098.2-761s1c1
Sequence:CCGGGCTGGAGGTCAAGTATATGAACTCGAGTTCATATACTTGACCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003098.2-1153s1c1
Sequence:CCGGTCAAGCAGATTGGCTGGCTAACTCGAGTTAGCCAGCCAATCTGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003098.2-602s21c1
Sequence:CCGGGCCTATTCTCATTTCCAAGATCTCGAGATCTTGGAAATGAGAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003098.2-587s21c1
Sequence:CCGGCCGGGAGAACAAGATGCCTATCTCGAGATAGGCATCTTGTTCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003098.2-761s21c1
Sequence:CCGGGCTGGAGGTCAAGTATATGAACTCGAGTTCATATACTTGACCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003098.2-790s21c1
Sequence:CCGGCACCGTATTTCAAGAACTCTACTCGAGTAGAGTTCTTGAAATACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003098
VALIDATED
SNTA1 MISSION shRNA Lentiviral Transduction Particles
syntrophin, alpha 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003098.2-602s1c1
Sequence:CCGGGCCTATTCTCATTTCCAAGATCTCGAGATCTTGGAAATGAGAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003098.2-790s1c1
Sequence:CCGGCACCGTATTTCAAGAACTCTACTCGAGTAGAGTTCTTGAAATACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003098.2-587s1c1
Sequence:CCGGCCGGGAGAACAAGATGCCTATCTCGAGATAGGCATCTTGTTCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003098.2-761s1c1
Sequence:CCGGGCTGGAGGTCAAGTATATGAACTCGAGTTCATATACTTGACCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003098.2-1153s1c1
Sequence:CCGGTCAAGCAGATTGGCTGGCTAACTCGAGTTAGCCAGCCAATCTGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003098.2-602s21c1
Sequence:CCGGGCCTATTCTCATTTCCAAGATCTCGAGATCTTGGAAATGAGAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003098.2-587s21c1
Sequence:CCGGCCGGGAGAACAAGATGCCTATCTCGAGATAGGCATCTTGTTCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003098.2-761s21c1
Sequence:CCGGGCTGGAGGTCAAGTATATGAACTCGAGTTCATATACTTGACCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003098.2-790s21c1
Sequence:CCGGCACCGTATTTCAAGAACTCTACTCGAGTAGAGTTCTTGAAATACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks