EMAIL THIS PAGE TO A FRIEND

SNTB1

syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1)

Synonyms: 59-DAP A1B BSYN2 DAPA1B SNT2 SNT2B1 TIP-43
UniProtKB ID: Q13884, A8K9E0, O14912, Q4KMG8
Gene ID:
Human(6641) Summary: Dystrophin is a large, rod-like cytoskeletal protein found at the inner surface of muscle fibers. Dystrophin is missing in Duchenne Muscular Dystrophy patients and is present in reduced amounts in Becker Muscular Dystrophy patients. The protein encoded by this gene is a peripheral membrane protein found associated with dystrophin and dystrophin-related proteins. This gene is a member of the syntrophin gene family, which contains at least two other structurally-related genes. [provided by RefSeq, Jul 2008]
Mouse(20649) syntrophin, basic 1
Rat(299940) syntrophin, beta 1
Domestic Rabbit(100354514) syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1)
naked mole-rat(101715580) syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1)
domestic guinea pig(100722957) syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1)
cow(617927) syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1)
sheep(101117171) syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1)
Zebrafish(431722) syntrophin, basic 1
Horse(100066500) syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1)
chicken(404774) syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1)
dog(482030) syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1)
domestic cat(101082628) syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1)
104 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021021 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021021 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021021 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016667 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016667 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016667 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU134121 MISSION® esiRNA esiRNA human SNTB1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021021 Rosetta Predictions human pricing
NM_001130542 Rosetta Predictions rat pricing
NM_016667 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021021 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186917 predicted 1515
2 SASI_Hs02_00354498 predicted 1652
3 SASI_Hs01_00186918 predicted 1075
4 SASI_Hs01_00186919 predicted 1757
5 SASI_Hs01_00186920 predicted 1648
6 SASI_Hs01_00186921 predicted 1913
7 SASI_Hs01_00186922 predicted 1758
8 SASI_Hs01_00186923 predicted 921
9 SASI_Hs01_00186924 predicted 1754
10 SASI_Hs01_00186925 predicted 1711
11 SASI_Hs01_00186926 predicted 1511
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130542 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255599 predicted 1130
2 SASI_Rn02_00255600 predicted 1623
3 SASI_Rn02_00255601 predicted 1687
4 SASI_Rn02_00255602 predicted 1436
5 SASI_Rn02_00255603 predicted 1744
6 SASI_Rn02_00255604 predicted 2110
7 SASI_Rn02_00255605 predicted 1342
8 SASI_Rn02_00255606 predicted 1869
9 SASI_Rn02_00255607 predicted 1569
10 SASI_Rn02_00255608 predicted 1189
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016667 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193241 predicted 1086
2 SASI_Mm01_00193242 predicted 1718
3 SASI_Mm01_00193243 predicted 1645
4 SASI_Mm01_00193244 predicted 888
5 SASI_Mm01_00193245 predicted 1819
6 SASI_Mm01_00193246 predicted 1705
7 SASI_Mm01_00193247 predicted 1825
8 SASI_Mm01_00193248 predicted 1158
9 SASI_Mm01_00193249 predicted 1142
10 SASI_Mm02_00323286 predicted 446
11 SASI_Mm01_00193240 predicted 1584
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021021
SNTB1 MISSION shRNA Bacterial Glycerol Stock
syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021021.3-971s21c1
Sequence:CCGGTGCTACGTCACTCGGAGTATGCTCGAGCATACTCCGAGTGACGTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021021.3-2065s21c1
Sequence:CCGGCTAGAACAGTACAAGGTTAAACTCGAGTTTAACCTTGTACTGTTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021021.3-1176s21c1
Sequence:CCGGTTGCTGGGAGCCGAGAGATTACTCGAGTAATCTCTCGGCTCCCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021021.3-1509s21c1
Sequence:CCGGTAGTACAGGGTTGCCACAATTCTCGAGAATTGTGGCAACCCTGTACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021021.2-1656s1c1
Sequence:CCGGCCATACATTATGAGAATGGATCTCGAGATCCATTCTCATAATGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021021.2-598s1c1
Sequence:CCGGCGAGTCCATCTCGAACCAGAACTCGAGTTCTGGTTCGAGATGGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021021.2-1863s1c1
Sequence:CCGGCCTTCCTGTCAGCTAAGATTACTCGAGTAATCTTAGCTGACAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021021.2-1394s1c1
Sequence:CCGGCCAGTTCACACATACCCTCTTCTCGAGAAGAGGGTATGTGTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021021.2-882s1c1
Sequence:CCGGCGCCCTATGTGAAGAAAGGATCTCGAGATCCTTTCTTCACATAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021021
SNTB1 MISSION shRNA shRNA Plasmid DNA
syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021021.3-971s21c1
Sequence:CCGGTGCTACGTCACTCGGAGTATGCTCGAGCATACTCCGAGTGACGTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021021.3-2065s21c1
Sequence:CCGGCTAGAACAGTACAAGGTTAAACTCGAGTTTAACCTTGTACTGTTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021021.3-1176s21c1
Sequence:CCGGTTGCTGGGAGCCGAGAGATTACTCGAGTAATCTCTCGGCTCCCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021021.3-1509s21c1
Sequence:CCGGTAGTACAGGGTTGCCACAATTCTCGAGAATTGTGGCAACCCTGTACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021021.2-1656s1c1
Sequence:CCGGCCATACATTATGAGAATGGATCTCGAGATCCATTCTCATAATGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021021.2-598s1c1
Sequence:CCGGCGAGTCCATCTCGAACCAGAACTCGAGTTCTGGTTCGAGATGGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021021.2-1863s1c1
Sequence:CCGGCCTTCCTGTCAGCTAAGATTACTCGAGTAATCTTAGCTGACAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021021.2-1394s1c1
Sequence:CCGGCCAGTTCACACATACCCTCTTCTCGAGAAGAGGGTATGTGTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021021.2-882s1c1
Sequence:CCGGCGCCCTATGTGAAGAAAGGATCTCGAGATCCTTTCTTCACATAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021021
SNTB1 MISSION shRNA Lentiviral Transduction Particles
syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021021.3-971s21c1
Sequence:CCGGTGCTACGTCACTCGGAGTATGCTCGAGCATACTCCGAGTGACGTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021021.3-2065s21c1
Sequence:CCGGCTAGAACAGTACAAGGTTAAACTCGAGTTTAACCTTGTACTGTTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021021.3-1176s21c1
Sequence:CCGGTTGCTGGGAGCCGAGAGATTACTCGAGTAATCTCTCGGCTCCCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021021.3-1509s21c1
Sequence:CCGGTAGTACAGGGTTGCCACAATTCTCGAGAATTGTGGCAACCCTGTACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021021.2-1656s1c1
Sequence:CCGGCCATACATTATGAGAATGGATCTCGAGATCCATTCTCATAATGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021021.2-598s1c1
Sequence:CCGGCGAGTCCATCTCGAACCAGAACTCGAGTTCTGGTTCGAGATGGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021021.2-1863s1c1
Sequence:CCGGCCTTCCTGTCAGCTAAGATTACTCGAGTAATCTTAGCTGACAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021021.2-1394s1c1
Sequence:CCGGCCAGTTCACACATACCCTCTTCTCGAGAAGAGGGTATGTGTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021021.2-882s1c1
Sequence:CCGGCGCCCTATGTGAAGAAAGGATCTCGAGATCCTTTCTTCACATAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016667
SNTB1 MISSION shRNA Bacterial Glycerol Stock
syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016667.1-1987s1c1
Sequence:CCGGCGACTTGCCTTTGGAAAGGAACTCGAGTTCCTTTCCAAAGGCAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016667.1-1393s1c1
Sequence:CCGGCTGGTTGTTCTGACTGAGAAACTCGAGTTTCTCAGTCAGAACAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016667.1-1392s1c1
Sequence:CCGGCCTGGTTGTTCTGACTGAGAACTCGAGTTCTCAGTCAGAACAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016667.1-1568s1c1
Sequence:CCGGGCACCAAGCAAGGAATTGAAACTCGAGTTTCAATTCCTTGCTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016667.1-949s1c1
Sequence:CCGGGCCACACCTTACGTGAAGAAACTCGAGTTTCTTCACGTAAGGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016667
SNTB1 MISSION shRNA shRNA Plasmid DNA
syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016667.1-1987s1c1
Sequence:CCGGCGACTTGCCTTTGGAAAGGAACTCGAGTTCCTTTCCAAAGGCAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016667.1-1393s1c1
Sequence:CCGGCTGGTTGTTCTGACTGAGAAACTCGAGTTTCTCAGTCAGAACAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016667.1-1392s1c1
Sequence:CCGGCCTGGTTGTTCTGACTGAGAACTCGAGTTCTCAGTCAGAACAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016667.1-1568s1c1
Sequence:CCGGGCACCAAGCAAGGAATTGAAACTCGAGTTTCAATTCCTTGCTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016667.1-949s1c1
Sequence:CCGGGCCACACCTTACGTGAAGAAACTCGAGTTTCTTCACGTAAGGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016667
SNTB1 MISSION shRNA Lentiviral Transduction Particles
syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016667.1-1987s1c1
Sequence:CCGGCGACTTGCCTTTGGAAAGGAACTCGAGTTCCTTTCCAAAGGCAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016667.1-1393s1c1
Sequence:CCGGCTGGTTGTTCTGACTGAGAAACTCGAGTTTCTCAGTCAGAACAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016667.1-1392s1c1
Sequence:CCGGCCTGGTTGTTCTGACTGAGAACTCGAGTTCTCAGTCAGAACAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016667.1-1568s1c1
Sequence:CCGGGCACCAAGCAAGGAATTGAAACTCGAGTTTCAATTCCTTGCTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016667.1-949s1c1
Sequence:CCGGGCCACACCTTACGTGAAGAAACTCGAGTTTCTTCACGTAAGGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks