EMAIL THIS PAGE TO A FRIEND

SNTB2

syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2)

Synonyms: D16S2531E EST25263 SNT2B2 SNT3 SNTL
UniProtKB ID: Q13425, Q9BY09
Gene ID:
Human(6645) Summary: Dystrophin is a large, rod-like cytoskeletal protein found at the inner surface of muscle fibers. Dystrophin is missing in Duchenne Muscular Dystrophy patients and is present in reduced amounts in Becker Muscular Dystrophy patients. The protein encoded by this gene is a peripheral membrane protein found associated with dystrophin and dystrophin-related proteins. This gene is a member of the syntrophin gene family, which contains at least two other structurally-related genes. [provided by RefSeq, Jul 2008]
Mouse(20650) syntrophin, basic 2
Rat(689421) syntrophin, beta 2
chicken(769654) syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2)
domestic cat(101082361) syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2)
Horse(100066988) syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2)
dog(479675) syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2)
cow(786534) syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2)
sheep(101112414) syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2)
domestic guinea pig(100724857) syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2)
naked mole-rat(101717267) syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2)
192 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009229 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009229 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009229 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006750 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006750 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006750 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006750 Rosetta Predictions human pricing
NM_130845 Rosetta Predictions human pricing
NM_009229 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006750 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162366 predicted 1273
2 SASI_Hs01_00162367 predicted 1250
3 SASI_Hs02_00342220 predicted 1100
4 SASI_Hs02_00342221 predicted 611
5 SASI_Hs02_00342222 predicted 1084
6 SASI_Hs01_00162371 predicted 1391
7 SASI_Hs02_00342223 predicted 1144
8 SASI_Hs02_00342224 predicted 979
9 SASI_Hs02_00342225 predicted 1171
10 SASI_Hs02_00342226 predicted 840
11 SASI_Hs01_00162368 predicted 1394
12 SASI_Hs01_00162369 predicted 1244
13 SASI_Hs01_00162370 predicted 1482
14 SASI_Hs01_00162372 predicted 1451
15 SASI_Hs01_00162373 predicted 1357
16 SASI_Hs01_00162374 predicted 1353
17 SASI_Hs01_00162375 predicted 1366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130845 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217332 predicted 1067
2 SASI_Hs01_00217333 predicted 1046
3 SASI_Hs01_00217334 predicted 1177
4 SASI_Hs01_00217335 predicted 1029
5 SASI_Hs01_00217336 predicted 1272
6 SASI_Hs01_00217337 predicted 1188
7 SASI_Hs01_00217338 predicted 1235
8 SASI_Hs01_00217339 predicted 1154
9 SASI_Hs01_00217340 predicted 1145
10 SASI_Hs01_00217341 predicted 1158
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009229 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129447 predicted 1049
2 SASI_Mm01_00129448 predicted 582
3 SASI_Mm01_00129449 predicted 1377
4 SASI_Mm01_00129450 predicted 197
5 SASI_Mm01_00129451 predicted 1219
6 SASI_Mm01_00129452 predicted 1115
7 SASI_Mm01_00129453 predicted 805
8 SASI_Mm01_00129454 predicted 1354
9 SASI_Mm01_00129455 predicted 768
10 SASI_Mm01_00129456 predicted 860
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009229
SNTB2 MISSION shRNA Bacterial Glycerol Stock
syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009229.2-573s1c1
Sequence:CCGGGTCAAATTCATCCGAGAAGTACTCGAGTACTTCTCGGATGAATTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009229.2-1545s1c1
Sequence:CCGGCCAAAGCCGATTGTATTTGTACTCGAGTACAAATACAATCGGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009229.2-1053s1c1
Sequence:CCGGGAGAAGGACTTGCTACTTTATCTCGAGATAAAGTAGCAAGTCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112915    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009229.2-3937s1c1
Sequence:CCGGGCCTAGAAATTGGTATCAAATCTCGAGATTTGATACCAATTTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009229.2-1546s1c1
Sequence:CCGGCAAAGCCGATTGTATTTGTATCTCGAGATACAAATACAATCGGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009229
SNTB2 MISSION shRNA shRNA Plasmid DNA
syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009229.2-573s1c1
Sequence:CCGGGTCAAATTCATCCGAGAAGTACTCGAGTACTTCTCGGATGAATTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009229.2-1545s1c1
Sequence:CCGGCCAAAGCCGATTGTATTTGTACTCGAGTACAAATACAATCGGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009229.2-1053s1c1
Sequence:CCGGGAGAAGGACTTGCTACTTTATCTCGAGATAAAGTAGCAAGTCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112915    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009229.2-3937s1c1
Sequence:CCGGGCCTAGAAATTGGTATCAAATCTCGAGATTTGATACCAATTTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009229.2-1546s1c1
Sequence:CCGGCAAAGCCGATTGTATTTGTATCTCGAGATACAAATACAATCGGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009229
SNTB2 MISSION shRNA Lentiviral Transduction Particles
syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009229.2-573s1c1
Sequence:CCGGGTCAAATTCATCCGAGAAGTACTCGAGTACTTCTCGGATGAATTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009229.2-1545s1c1
Sequence:CCGGCCAAAGCCGATTGTATTTGTACTCGAGTACAAATACAATCGGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009229.2-1053s1c1
Sequence:CCGGGAGAAGGACTTGCTACTTTATCTCGAGATAAAGTAGCAAGTCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112915    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009229.2-3937s1c1
Sequence:CCGGGCCTAGAAATTGGTATCAAATCTCGAGATTTGATACCAATTTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009229.2-1546s1c1
Sequence:CCGGCAAAGCCGATTGTATTTGTATCTCGAGATACAAATACAATCGGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006750
VALIDATED
SNTB2 MISSION shRNA Bacterial Glycerol Stock
syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006750.2-1204s1c1
Sequence:CCGGCCCTTGGATCTGACCTTACATCTCGAGATGTAAGGTCAGATCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006750.2-1382s1c1
Sequence:CCGGCCAAGAGGTGAGGCTTACTATCTCGAGATAGTAAGCCTCACCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006750.2-747s1c1
Sequence:CCGGAGGAAGATCATCCCTCTCAAACTCGAGTTTGAGAGGGATGATCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006750.2-611s1c1
Sequence:CCGGCCGAGAAGTAACACCATATATCTCGAGATATATGGTGTTACTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006750.2-1306s1c1
Sequence:CCGGCCAGGATACTTGTTCAGGGTTCTCGAGAACCCTGAACAAGTATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006750.2-747s1c2
Sequence:CCGGAGGAAGATCATCCCTCTCAAACTCGAGTTTGAGAGGGATGATCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_006750.3-898s21c1
Sequence:CCGGTAGCTATCCACACCAACATAACTCGAGTTATGTTGGTGTGGATAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303927    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006750.3-1772s21c1
Sequence:CCGGGCTGAACCATAACCGTGTTTACTCGAGTAAACACGGTTATGGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_006750.3-1306s21c1
Sequence:CCGGCCAGGATACTTGTTCAGGGTTCTCGAGAACCCTGAACAAGTATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_006750.3-611s21c1
Sequence:CCGGCCGAGAAGTAACACCATATATCTCGAGATATATGGTGTTACTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_006750.3-1204s21c1
Sequence:CCGGCCCTTGGATCTGACCTTACATCTCGAGATGTAAGGTCAGATCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006750
VALIDATED
SNTB2 MISSION shRNA shRNA Plasmid DNA
syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006750.2-1204s1c1
Sequence:CCGGCCCTTGGATCTGACCTTACATCTCGAGATGTAAGGTCAGATCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006750.2-1382s1c1
Sequence:CCGGCCAAGAGGTGAGGCTTACTATCTCGAGATAGTAAGCCTCACCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006750.2-747s1c1
Sequence:CCGGAGGAAGATCATCCCTCTCAAACTCGAGTTTGAGAGGGATGATCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006750.2-611s1c1
Sequence:CCGGCCGAGAAGTAACACCATATATCTCGAGATATATGGTGTTACTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006750.2-1306s1c1
Sequence:CCGGCCAGGATACTTGTTCAGGGTTCTCGAGAACCCTGAACAAGTATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006750.2-747s1c2
Sequence:CCGGAGGAAGATCATCCCTCTCAAACTCGAGTTTGAGAGGGATGATCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_006750.3-898s21c1
Sequence:CCGGTAGCTATCCACACCAACATAACTCGAGTTATGTTGGTGTGGATAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303927    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006750.3-1772s21c1
Sequence:CCGGGCTGAACCATAACCGTGTTTACTCGAGTAAACACGGTTATGGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_006750.3-1306s21c1
Sequence:CCGGCCAGGATACTTGTTCAGGGTTCTCGAGAACCCTGAACAAGTATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_006750.3-611s21c1
Sequence:CCGGCCGAGAAGTAACACCATATATCTCGAGATATATGGTGTTACTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_006750.3-1204s21c1
Sequence:CCGGCCCTTGGATCTGACCTTACATCTCGAGATGTAAGGTCAGATCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006750
VALIDATED
SNTB2 MISSION shRNA Lentiviral Transduction Particles
syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006750.2-1204s1c1
Sequence:CCGGCCCTTGGATCTGACCTTACATCTCGAGATGTAAGGTCAGATCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006750.2-1382s1c1
Sequence:CCGGCCAAGAGGTGAGGCTTACTATCTCGAGATAGTAAGCCTCACCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006750.2-747s1c1
Sequence:CCGGAGGAAGATCATCCCTCTCAAACTCGAGTTTGAGAGGGATGATCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006750.2-611s1c1
Sequence:CCGGCCGAGAAGTAACACCATATATCTCGAGATATATGGTGTTACTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006750.2-1306s1c1
Sequence:CCGGCCAGGATACTTGTTCAGGGTTCTCGAGAACCCTGAACAAGTATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006750.2-747s1c2
Sequence:CCGGAGGAAGATCATCCCTCTCAAACTCGAGTTTGAGAGGGATGATCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_006750.3-898s21c1
Sequence:CCGGTAGCTATCCACACCAACATAACTCGAGTTATGTTGGTGTGGATAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303927    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006750.3-1772s21c1
Sequence:CCGGGCTGAACCATAACCGTGTTTACTCGAGTAAACACGGTTATGGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_006750.3-1306s21c1
Sequence:CCGGCCAGGATACTTGTTCAGGGTTCTCGAGAACCCTGAACAAGTATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_006750.3-611s21c1
Sequence:CCGGCCGAGAAGTAACACCATATATCTCGAGATATATGGTGTTACTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_006750.3-1204s21c1
Sequence:CCGGCCCTTGGATCTGACCTTACATCTCGAGATGTAAGGTCAGATCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks