EMAIL THIS PAGE TO A FRIEND

SNTG1

syntrophin, gamma 1

Synonyms: G1SYN SYN4
UniProtKB ID: Q9NSN8, Q2M3Q0, Q9NY98
Gene ID:
Human(54212) Summary: The protein encoded by this gene is a member of the syntrophin family. Syntrophins are cytoplasmic peripheral membrane proteins that typically contain 2 pleckstrin homology (PH) domains, a PDZ domain that bisects the first PH domain, and a C-terminal domain that mediates dystrophin binding. This gene is specifically expressed in the brain. Transcript variants for this gene have been described, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Mouse(71096) syntrophin, gamma 1
Rat(500394) syntrophin, gamma 1
naked mole-rat(101716771) syntrophin, gamma 1
Domestic Rabbit(100346182) syntrophin, gamma 1
domestic guinea pig(100719856) syntrophin, gamma 1
cow(517353) syntrophin, gamma 1
sheep(101112575) syntrophin, gamma 1
Zebrafish(100330925) syntrophin, gamma 1
Horse(100050126) syntrophin, gamma 1
domestic cat(101091502) syntrophin, gamma 1
dog(486943) syntrophin, gamma 1
chicken(421113) syntrophin, gamma 1
Gene Class: Cytoskeleton
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018967 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018967 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018967 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027671 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027671 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027671 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018967 Rosetta Predictions human pricing
XM_001066932 Rosetta Predictions rat pricing
XM_575753 Rosetta Predictions rat pricing
NM_027671 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018967 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063666 predicted 1509
2 SASI_Hs01_00063667 predicted 975
3 SASI_Hs01_00063669 predicted 1127
4 SASI_Hs01_00063670 predicted 459
5 SASI_Hs01_00063671 predicted 1603
6 SASI_Hs01_00063672 predicted 1493
7 SASI_Hs01_00063673 predicted 1227
8 SASI_Hs02_00352448 predicted 532
9 SASI_Hs01_00063674 predicted 1141
10 SASI_Hs01_00063675 predicted 819
11 SASI_Hs01_00063668 predicted 756
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066932 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00319242 predicted 1268
2 SASI_Rn02_00319243 predicted 1567
3 SASI_Rn02_00319244 predicted 232
4 SASI_Rn02_00319245 predicted 819
5 SASI_Rn02_00319246 predicted 478
6 SASI_Rn02_00319247 predicted 878
7 SASI_Rn02_00319248 predicted 1208
8 SASI_Rn02_00319249 predicted 1276
9 SASI_Rn02_00319250 predicted 891
10 SASI_Rn02_00319251 predicted 1108
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575753 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404223 predicted 1215
2 SASI_Rn02_00404224 predicted 1521
3 SASI_Rn02_00404225 predicted 761
4 SASI_Rn02_00404226 predicted 1311
5 SASI_Rn02_00404227 predicted 1379
6 SASI_Rn02_00404228 predicted 432
7 SASI_Rn02_00404229 predicted 827
8 SASI_Rn02_00404230 predicted 1157
9 SASI_Rn02_00404231 predicted 1230
10 SASI_Rn02_00404232 predicted 274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027671 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332554 predicted 2260
2 SASI_Mm02_00332555 predicted 2172
3 SASI_Mm02_00332556 predicted 1869
4 SASI_Mm02_00332557 predicted 2130
5 SASI_Mm02_00332558 predicted 3340
6 SASI_Mm02_00332559 predicted 1981
7 SASI_Mm02_00332560 predicted 2642
8 SASI_Mm02_00332561 predicted 3287
9 SASI_Mm02_00332562 predicted 3023
10 SASI_Mm02_00332563 predicted 3045
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018967
SNTG1 MISSION shRNA Bacterial Glycerol Stock
syntrophin, gamma 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018967.2-1232s21c1
Sequence:CCGGGCTCATGTCTCTACAAGTTTCCTCGAGGAAACTTGTAGAGACATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018967.2-1507s21c1
Sequence:CCGGGTGCTAGAAAGTCATCTAATGCTCGAGCATTAGATGACTTTCTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018967.2-518s21c1
Sequence:CCGGGAGGAGCAGAACATAACATTCCTCGAGGAATGTTATGTTCTGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018967.2-1759s21c1
Sequence:CCGGGCTTGTTTGGACCCTCTATTTCTCGAGAAATAGAGGGTCCAAACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018967.1-938s1c1
Sequence:CCGGGCTGGAGAAGAAGTGACTCTACTCGAGTAGAGTCACTTCTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018967.1-834s1c1
Sequence:CCGGCGGAACTTTCAGGACTACTTTCTCGAGAAAGTAGTCCTGAAAGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018967.1-701s1c1
Sequence:CCGGGAGCCTTTCTATTCTGGTGAACTCGAGTTCACCAGAATAGAAAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018967.1-2082s1c1
Sequence:CCGGCCACGAGCAAAGCAAAGTATACTCGAGTATACTTTGCTTTGCTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018967.1-1943s1c1
Sequence:CCGGGAAGCAAAGGAGTTGGAATTTCTCGAGAAATTCCAACTCCTTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018967.1-1976s1c1
Sequence:CCGGGCTGTTCTTCACTGCATTCATCTCGAGATGAATGCAGTGAAGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018967
SNTG1 MISSION shRNA shRNA Plasmid DNA
syntrophin, gamma 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018967.2-1232s21c1
Sequence:CCGGGCTCATGTCTCTACAAGTTTCCTCGAGGAAACTTGTAGAGACATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018967.2-1507s21c1
Sequence:CCGGGTGCTAGAAAGTCATCTAATGCTCGAGCATTAGATGACTTTCTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018967.2-518s21c1
Sequence:CCGGGAGGAGCAGAACATAACATTCCTCGAGGAATGTTATGTTCTGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018967.2-1759s21c1
Sequence:CCGGGCTTGTTTGGACCCTCTATTTCTCGAGAAATAGAGGGTCCAAACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018967.1-938s1c1
Sequence:CCGGGCTGGAGAAGAAGTGACTCTACTCGAGTAGAGTCACTTCTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018967.1-834s1c1
Sequence:CCGGCGGAACTTTCAGGACTACTTTCTCGAGAAAGTAGTCCTGAAAGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018967.1-701s1c1
Sequence:CCGGGAGCCTTTCTATTCTGGTGAACTCGAGTTCACCAGAATAGAAAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018967.1-2082s1c1
Sequence:CCGGCCACGAGCAAAGCAAAGTATACTCGAGTATACTTTGCTTTGCTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018967.1-1943s1c1
Sequence:CCGGGAAGCAAAGGAGTTGGAATTTCTCGAGAAATTCCAACTCCTTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018967.1-1976s1c1
Sequence:CCGGGCTGTTCTTCACTGCATTCATCTCGAGATGAATGCAGTGAAGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018967
SNTG1 MISSION shRNA Lentiviral Transduction Particles
syntrophin, gamma 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018967.2-1232s21c1
Sequence:CCGGGCTCATGTCTCTACAAGTTTCCTCGAGGAAACTTGTAGAGACATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018967.2-1507s21c1
Sequence:CCGGGTGCTAGAAAGTCATCTAATGCTCGAGCATTAGATGACTTTCTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018967.2-518s21c1
Sequence:CCGGGAGGAGCAGAACATAACATTCCTCGAGGAATGTTATGTTCTGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018967.2-1759s21c1
Sequence:CCGGGCTTGTTTGGACCCTCTATTTCTCGAGAAATAGAGGGTCCAAACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018967.1-938s1c1
Sequence:CCGGGCTGGAGAAGAAGTGACTCTACTCGAGTAGAGTCACTTCTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018967.1-834s1c1
Sequence:CCGGCGGAACTTTCAGGACTACTTTCTCGAGAAAGTAGTCCTGAAAGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018967.1-701s1c1
Sequence:CCGGGAGCCTTTCTATTCTGGTGAACTCGAGTTCACCAGAATAGAAAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018967.1-2082s1c1
Sequence:CCGGCCACGAGCAAAGCAAAGTATACTCGAGTATACTTTGCTTTGCTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018967.1-1943s1c1
Sequence:CCGGGAAGCAAAGGAGTTGGAATTTCTCGAGAAATTCCAACTCCTTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018967.1-1976s1c1
Sequence:CCGGGCTGTTCTTCACTGCATTCATCTCGAGATGAATGCAGTGAAGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027671
SNTG1 MISSION shRNA Bacterial Glycerol Stock
syntrophin, gamma 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027671.3-3423s1c1
Sequence:CCGGGCTGTGTTTAATCTTACTGTACTCGAGTACAGTAAGATTAAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027671.3-2102s1c1
Sequence:CCGGCCAAGCAATAGCATCTAACATCTCGAGATGTTAGATGCTATTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027671.3-2796s1c1
Sequence:CCGGGCTTGTTTGGACCCTCTGTTTCTCGAGAAACAGAGGGTCCAAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027671.3-1560s1c1
Sequence:CCGGGCAGAACATAACATCCCGGTTCTCGAGAACCGGGATGTTATGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027671.3-2393s1c1
Sequence:CCGGGCGGAAACATTGCTTCACTATCTCGAGATAGTGAAGCAATGTTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027671
SNTG1 MISSION shRNA shRNA Plasmid DNA
syntrophin, gamma 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027671.3-3423s1c1
Sequence:CCGGGCTGTGTTTAATCTTACTGTACTCGAGTACAGTAAGATTAAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027671.3-2102s1c1
Sequence:CCGGCCAAGCAATAGCATCTAACATCTCGAGATGTTAGATGCTATTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027671.3-2796s1c1
Sequence:CCGGGCTTGTTTGGACCCTCTGTTTCTCGAGAAACAGAGGGTCCAAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027671.3-1560s1c1
Sequence:CCGGGCAGAACATAACATCCCGGTTCTCGAGAACCGGGATGTTATGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027671.3-2393s1c1
Sequence:CCGGGCGGAAACATTGCTTCACTATCTCGAGATAGTGAAGCAATGTTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027671
SNTG1 MISSION shRNA Lentiviral Transduction Particles
syntrophin, gamma 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027671.3-3423s1c1
Sequence:CCGGGCTGTGTTTAATCTTACTGTACTCGAGTACAGTAAGATTAAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027671.3-2102s1c1
Sequence:CCGGCCAAGCAATAGCATCTAACATCTCGAGATGTTAGATGCTATTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027671.3-2796s1c1
Sequence:CCGGGCTTGTTTGGACCCTCTGTTTCTCGAGAAACAGAGGGTCCAAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027671.3-1560s1c1
Sequence:CCGGGCAGAACATAACATCCCGGTTCTCGAGAACCGGGATGTTATGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027671.3-2393s1c1
Sequence:CCGGGCGGAAACATTGCTTCACTATCTCGAGATAGTGAAGCAATGTTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks