EMAIL THIS PAGE TO A FRIEND

SNTG2

syntrophin, gamma 2

Synonyms: G2SYN SYN5
UniProtKB ID: Q9NY99, Q05AH5
Gene ID:
Human(54221) Summary: This gene encodes a protein belonging to the syntrophin family. Syntrophins are cytoplasmic peripheral membrane proteins that bind to components of mechanosenstive sodium channels and the extreme carboxy-terminal domain of dystrophin and dystrophin-related proteins. The PDZ domain of this protein product interacts with a protein component of a mechanosensitive sodium channel that affects channel gating. Absence or reduction of this protein product has been associated with Duchenne muscular dystrophy. There is evidence of alternative splicing yet the full-length nature of these variants has not been described. [provided by RefSeq, Jul 2008]
Mouse(268534) syntrophin, gamma 2
Rat(298936) syntrophin, gamma 2
chicken(421913) syntrophin, gamma 2
dog(607319) syntrophin, gamma 2
Horse(100072966) syntrophin, gamma 2
domestic cat(101098946) syntrophin, gamma 2
cow(615686) syntrophin, gamma 2
domestic guinea pig(100723988) syntrophin, gamma 2
naked mole-rat(101704906) syntrophin, gamma 2
Gene Class: Cytoskeleton
91 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501149 Anti-SNTG2 (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172951 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172951 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172951 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018968 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018968 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018968 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018968 Rosetta Predictions human pricing
NM_001106720 Rosetta Predictions rat pricing
NM_172951 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018968 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185759 predicted 1560
2 SASI_Hs01_00185760 predicted 270
3 SASI_Hs01_00185761 predicted 1234
4 SASI_Hs01_00185762 predicted 810
5 SASI_Hs01_00185763 predicted 543
6 SASI_Hs01_00185764 predicted 341
7 SASI_Hs02_00352449 predicted 682
8 SASI_Hs01_00185765 predicted 563
9 SASI_Hs01_00185767 predicted 1182
10 SASI_Hs01_00185768 predicted 1164
11 SASI_Hs01_00185766 predicted 1092
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106720 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221728 predicted 1136
2 SASI_Rn02_00221729 predicted 702
3 SASI_Rn02_00221730 predicted 1296
4 SASI_Rn02_00221731 predicted 673
5 SASI_Rn02_00221732 predicted 503
6 SASI_Rn02_00221733 predicted 735
7 SASI_Rn02_00221734 predicted 541
8 SASI_Rn02_00221735 predicted 940
9 SASI_Rn02_00221736 predicted 1010
10 SASI_Rn02_00221737 predicted 1126
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172951 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049803 predicted 444
2 SASI_Mm01_00049804 predicted 1529
3 SASI_Mm02_00344986 predicted 1511
4 SASI_Mm01_00049806 predicted 1349
5 SASI_Mm01_00049808 predicted 730
6 SASI_Mm01_00049809 predicted 308
7 SASI_Mm02_00344987 predicted 1028
8 SASI_Mm01_00049810 predicted 1027
9 SASI_Mm01_00049811 predicted 715
10 SASI_Mm01_00049812 predicted 209
11 SASI_Mm01_00049805 predicted 1489
12 SASI_Mm01_00049807 predicted 790
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172951
SNTG2 MISSION shRNA Bacterial Glycerol Stock
syntrophin, gamma 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172951.1-907s1c1
Sequence:CCGGGCGTTCAATCTCAACCAACATCTCGAGATGTTGGTTGAGATTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172951.1-541s1c1
Sequence:CCGGCGTCACCATCACTGTTGAGTACTCGAGTACTCAACAGTGATGGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172951.1-904s1c1
Sequence:CCGGGTTGCGTTCAATCTCAACCAACTCGAGTTGGTTGAGATTGAACGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172951.1-1573s1c1
Sequence:CCGGGCAGATTGAAACGAAGGAGCTCTCGAGAGCTCCTTCGTTTCAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172951.1-464s1c1
Sequence:CCGGCTACAGGTTAATGGCATTAATCTCGAGATTAATGCCATTAACCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172951
SNTG2 MISSION shRNA shRNA Plasmid DNA
syntrophin, gamma 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172951.1-907s1c1
Sequence:CCGGGCGTTCAATCTCAACCAACATCTCGAGATGTTGGTTGAGATTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172951.1-541s1c1
Sequence:CCGGCGTCACCATCACTGTTGAGTACTCGAGTACTCAACAGTGATGGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172951.1-904s1c1
Sequence:CCGGGTTGCGTTCAATCTCAACCAACTCGAGTTGGTTGAGATTGAACGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172951.1-1573s1c1
Sequence:CCGGGCAGATTGAAACGAAGGAGCTCTCGAGAGCTCCTTCGTTTCAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172951.1-464s1c1
Sequence:CCGGCTACAGGTTAATGGCATTAATCTCGAGATTAATGCCATTAACCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172951
SNTG2 MISSION shRNA Lentiviral Transduction Particles
syntrophin, gamma 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172951.1-907s1c1
Sequence:CCGGGCGTTCAATCTCAACCAACATCTCGAGATGTTGGTTGAGATTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172951.1-541s1c1
Sequence:CCGGCGTCACCATCACTGTTGAGTACTCGAGTACTCAACAGTGATGGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172951.1-904s1c1
Sequence:CCGGGTTGCGTTCAATCTCAACCAACTCGAGTTGGTTGAGATTGAACGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172951.1-1573s1c1
Sequence:CCGGGCAGATTGAAACGAAGGAGCTCTCGAGAGCTCCTTCGTTTCAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172951.1-464s1c1
Sequence:CCGGCTACAGGTTAATGGCATTAATCTCGAGATTAATGCCATTAACCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018968
SNTG2 MISSION shRNA Bacterial Glycerol Stock
syntrophin, gamma 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018968.1-609s1c1
Sequence:CCGGGCATTTCTGAAGCTCCCGTTACTCGAGTAACGGGAGCTTCAGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018968.1-810s1c1
Sequence:CCGGGCTCGCATCTCAAGGTACAAACTCGAGTTTGTACCTTGAGATGCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018968.2-270s21c1
Sequence:CCGGACGAAAGAGGTGCTGACAATTCTCGAGAATTGTCAGCACCTCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018968.2-374s21c1
Sequence:CCGGCGGCTTGGGCCTGAGTATAAACTCGAGTTTATACTCAGGCCCAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018968.2-808s21c1
Sequence:CCGGCTCGCATCTCAAGGTACAAAGCTCGAGCTTTGTACCTTGAGATGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018968.2-409s21c1
Sequence:CCGGACAACGTCCCTGTCGTCATATCTCGAGATATGACGACAGGGACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018968.2-571s21c1
Sequence:CCGGTTACCATCACCGTTGAGTATCCTCGAGGATACTCAACGGTGATGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018968
SNTG2 MISSION shRNA shRNA Plasmid DNA
syntrophin, gamma 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018968.1-609s1c1
Sequence:CCGGGCATTTCTGAAGCTCCCGTTACTCGAGTAACGGGAGCTTCAGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018968.1-810s1c1
Sequence:CCGGGCTCGCATCTCAAGGTACAAACTCGAGTTTGTACCTTGAGATGCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018968.2-270s21c1
Sequence:CCGGACGAAAGAGGTGCTGACAATTCTCGAGAATTGTCAGCACCTCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018968.2-374s21c1
Sequence:CCGGCGGCTTGGGCCTGAGTATAAACTCGAGTTTATACTCAGGCCCAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018968.2-808s21c1
Sequence:CCGGCTCGCATCTCAAGGTACAAAGCTCGAGCTTTGTACCTTGAGATGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018968.2-409s21c1
Sequence:CCGGACAACGTCCCTGTCGTCATATCTCGAGATATGACGACAGGGACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018968.2-571s21c1
Sequence:CCGGTTACCATCACCGTTGAGTATCCTCGAGGATACTCAACGGTGATGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018968
SNTG2 MISSION shRNA Lentiviral Transduction Particles
syntrophin, gamma 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018968.1-609s1c1
Sequence:CCGGGCATTTCTGAAGCTCCCGTTACTCGAGTAACGGGAGCTTCAGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018968.1-810s1c1
Sequence:CCGGGCTCGCATCTCAAGGTACAAACTCGAGTTTGTACCTTGAGATGCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018968.2-270s21c1
Sequence:CCGGACGAAAGAGGTGCTGACAATTCTCGAGAATTGTCAGCACCTCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018968.2-374s21c1
Sequence:CCGGCGGCTTGGGCCTGAGTATAAACTCGAGTTTATACTCAGGCCCAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018968.2-808s21c1
Sequence:CCGGCTCGCATCTCAAGGTACAAAGCTCGAGCTTTGTACCTTGAGATGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018968.2-409s21c1
Sequence:CCGGACAACGTCCCTGTCGTCATATCTCGAGATATGACGACAGGGACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018968.2-571s21c1
Sequence:CCGGTTACCATCACCGTTGAGTATCCTCGAGGATACTCAACGGTGATGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks