EMAIL THIS PAGE TO A FRIEND

SNTN

sentan, cilia apical structure protein

Synonyms: S100A1L S100AL sentan
UniProtKB ID: A6NMZ2, B7FF65
Gene ID:
Mouse(218739) sentan, cilia apical structure protein
Rat(498456) sentan, cilia apical structure protein
naked mole-rat(101705406) sentan, cilia apical structure protein
cow(768326) sentan, cilia apical structure protein
sheep(101119763) sentan, cilia apical structure protein
chicken(416076) sentan, cilia apical structure protein
domestic cat(101084347) sentan, cilia apical structure protein
dog(484703) sentan, cilia apical structure protein
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177624 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177624 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177624 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080537 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080537 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080537 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU056061 MISSION® esiRNA esiRNA human AC136289.2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080537 Rosetta Predictions human pricing
XM_059578 Rosetta Predictions human pricing
XM_930543 Rosetta Predictions human pricing
XM_935351 Rosetta Predictions human pricing
NM_001109098 Rosetta Predictions rat pricing
NM_177624 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080537 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315797 predicted 327
2 SASI_Hs02_00315798 predicted 410
3 SASI_Hs02_00315799 predicted 285
4 SASI_Hs02_00315800 predicted 381
5 SASI_Hs02_00315801 predicted 231
6 SASI_Hs02_00315802 predicted 404
7 SASI_Hs02_00315803 predicted 225
8 SASI_Hs02_00315804 predicted 383
9 SASI_Hs02_00315805 predicted 373
10 SASI_Hs02_00315806 predicted 223
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_059578 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00288245 predicted 408
2 SASI_Hs01_00288246 predicted 491
3 SASI_Hs01_00288247 predicted 688
4 SASI_Hs01_00288248 predicted 254
5 SASI_Hs01_00288249 predicted 666
6 SASI_Hs01_00288250 predicted 674
7 SASI_Hs01_00288251 predicted 22
8 SASI_Hs01_00288252 predicted 767
9 SASI_Hs01_00288253 predicted 749
10 SASI_Hs01_00288254 predicted 705
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930543 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00249244 predicted 414
2 SASI_Hs01_00249245 predicted 286
3 SASI_Hs01_00249246 predicted 267
4 SASI_Hs01_00249247 predicted 229
5 SASI_Hs01_00249248 predicted 408
6 SASI_Hs01_00249249 predicted 379
7 SASI_Hs01_00249250 predicted 380
8 SASI_Hs01_00249251 predicted 229
9 SASI_Hs01_00249252 predicted 260
10 SASI_Hs01_00249253 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935351 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00275302 predicted 593
2 SASI_Hs01_00275303 predicted 579
3 SASI_Hs01_00275304 predicted 142
4 SASI_Hs01_00275305 predicted 239
5 SASI_Hs01_00275306 predicted 488
6 SASI_Hs01_00275307 predicted 198
7 SASI_Hs01_00275308 predicted 593
8 SASI_Hs01_00275309 predicted 581
9 SASI_Hs01_00275310 predicted 609
10 SASI_Hs01_00275311 predicted 565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109098 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245110 predicted 193
2 SASI_Rn02_00245111 predicted 925
3 SASI_Rn02_00245112 predicted 333
4 SASI_Rn02_00245113 predicted 255
5 SASI_Rn02_00245114 predicted 258
6 SASI_Rn02_00245115 predicted 270
7 SASI_Rn02_00245116 predicted 271
8 SASI_Rn02_00245117 predicted 325
9 SASI_Rn02_00245118 predicted 912
10 SASI_Rn02_00245119 predicted 283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177624 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153880 predicted 410
2 SASI_Mm01_00153881 predicted 471
3 SASI_Mm01_00153882 predicted 192
4 SASI_Mm01_00153883 predicted 366
5 SASI_Mm01_00153884 predicted 688
6 SASI_Mm01_00153885 predicted 513
7 SASI_Mm01_00153886 predicted 332
8 SASI_Mm01_00153887 predicted 497
9 SASI_Mm01_00153888 predicted 573
10 SASI_Mm01_00153889 predicted 565
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177624
SNTN MISSION shRNA Bacterial Glycerol Stock
sentan, cilia apical structure protein
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000448022    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177624.3-905s21c1
Sequence:CCGGATGTGATCTCTACCTTAATTTCTCGAGAAATTAAGGTAGAGATCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177624.3-574s21c1
Sequence:CCGGTATGGTTTGTGACACGATAAACTCGAGTTTATCGTGTCACAAACCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177624.2-95s1c1
Sequence:CCGGCAGCATCCATTTCAGCACCTACTCGAGTAGGTGCTGAAATGGATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177624.2-238s1c1
Sequence:CCGGCCTGATGGTAAACTTGGGAAACTCGAGTTTCCCAAGTTTACCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177624.2-427s1c1
Sequence:CCGGCTGCTACGAAATATGTGGAATCTCGAGATTCCACATATTTCGTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177624.2-273s1c1
Sequence:CCGGACTGCTACAAACCCAATTTAACTCGAGTTAAATTGGGTTTGTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177624.2-751s1c1
Sequence:CCGGCCCTTTCTCATGTTTACACAACTCGAGTTGTGTAAACATGAGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177624
SNTN MISSION shRNA shRNA Plasmid DNA
sentan, cilia apical structure protein
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000448022    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177624.3-905s21c1
Sequence:CCGGATGTGATCTCTACCTTAATTTCTCGAGAAATTAAGGTAGAGATCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177624.3-574s21c1
Sequence:CCGGTATGGTTTGTGACACGATAAACTCGAGTTTATCGTGTCACAAACCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177624.2-95s1c1
Sequence:CCGGCAGCATCCATTTCAGCACCTACTCGAGTAGGTGCTGAAATGGATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177624.2-238s1c1
Sequence:CCGGCCTGATGGTAAACTTGGGAAACTCGAGTTTCCCAAGTTTACCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177624.2-427s1c1
Sequence:CCGGCTGCTACGAAATATGTGGAATCTCGAGATTCCACATATTTCGTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177624.2-273s1c1
Sequence:CCGGACTGCTACAAACCCAATTTAACTCGAGTTAAATTGGGTTTGTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177624.2-751s1c1
Sequence:CCGGCCCTTTCTCATGTTTACACAACTCGAGTTGTGTAAACATGAGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177624
SNTN MISSION shRNA Lentiviral Transduction Particles
sentan, cilia apical structure protein
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000448022    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177624.3-905s21c1
Sequence:CCGGATGTGATCTCTACCTTAATTTCTCGAGAAATTAAGGTAGAGATCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177624.3-574s21c1
Sequence:CCGGTATGGTTTGTGACACGATAAACTCGAGTTTATCGTGTCACAAACCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177624.2-95s1c1
Sequence:CCGGCAGCATCCATTTCAGCACCTACTCGAGTAGGTGCTGAAATGGATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177624.2-238s1c1
Sequence:CCGGCCTGATGGTAAACTTGGGAAACTCGAGTTTCCCAAGTTTACCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177624.2-427s1c1
Sequence:CCGGCTGCTACGAAATATGTGGAATCTCGAGATTCCACATATTTCGTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177624.2-273s1c1
Sequence:CCGGACTGCTACAAACCCAATTTAACTCGAGTTAAATTGGGTTTGTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177624.2-751s1c1
Sequence:CCGGCCCTTTCTCATGTTTACACAACTCGAGTTGTGTAAACATGAGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080537
SNTN MISSION shRNA Bacterial Glycerol Stock
sentan, cilia apical structure protein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080537.1-737s21c1
Sequence:CCGGGCACTCTACTTATAGTCATTGCTCGAGCAATGACTATAAGTAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080537.1-386s21c1
Sequence:CCGGCTTCATGATCTTGCTCTTAAGCTCGAGCTTAAGAGCAAGATCATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080537.1-229s21c1
Sequence:CCGGCTTCTGACTCTGATGGTAAACCTCGAGGTTTACCATCAGAGTCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080537.1-272s21c1
Sequence:CCGGTCTGCTGCAAACCCAATTTAGCTCGAGCTAAATTGGGTTTGCAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080537.1-296s21c1
Sequence:CCGGTTTCGCAGAGGGACAAGAAACCTCGAGGTTTCTTGTCCCTCTGCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080537
SNTN MISSION shRNA shRNA Plasmid DNA
sentan, cilia apical structure protein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080537.1-737s21c1
Sequence:CCGGGCACTCTACTTATAGTCATTGCTCGAGCAATGACTATAAGTAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080537.1-386s21c1
Sequence:CCGGCTTCATGATCTTGCTCTTAAGCTCGAGCTTAAGAGCAAGATCATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080537.1-229s21c1
Sequence:CCGGCTTCTGACTCTGATGGTAAACCTCGAGGTTTACCATCAGAGTCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080537.1-272s21c1
Sequence:CCGGTCTGCTGCAAACCCAATTTAGCTCGAGCTAAATTGGGTTTGCAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080537.1-296s21c1
Sequence:CCGGTTTCGCAGAGGGACAAGAAACCTCGAGGTTTCTTGTCCCTCTGCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080537
SNTN MISSION shRNA Lentiviral Transduction Particles
sentan, cilia apical structure protein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080537.1-737s21c1
Sequence:CCGGGCACTCTACTTATAGTCATTGCTCGAGCAATGACTATAAGTAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080537.1-386s21c1
Sequence:CCGGCTTCATGATCTTGCTCTTAAGCTCGAGCTTAAGAGCAAGATCATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080537.1-229s21c1
Sequence:CCGGCTTCTGACTCTGATGGTAAACCTCGAGGTTTACCATCAGAGTCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080537.1-272s21c1
Sequence:CCGGTCTGCTGCAAACCCAATTTAGCTCGAGCTAAATTGGGTTTGCAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080537.1-296s21c1
Sequence:CCGGTTTCGCAGAGGGACAAGAAACCTCGAGGTTTCTTGTCCCTCTGCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks