EMAIL THIS PAGE TO A FRIEND

SNUPN

snurportin 1

Synonyms: KPNBL RNUT1 Snurportin1
UniProtKB ID: O95149, A6NE34, A8K0B0, D3DW76
Gene ID:
Human(10073) Summary: The nuclear import of the spliceosomal snRNPs U1, U2, U4 and U5, is dependent on the presence of a complex nuclear localization signal. The latter is composed of the 5'-2,2,7-terminal trimethylguanosine (m3G) cap structure of the U snRNA and the Sm core domain. The protein encoded by this gene interacts specifically with m3G-cap and functions as an snRNP-specific nuclear import receptor. Alternatively spliced transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(66069) snurportin 1
Rat(316108) snurportin 1
Zebrafish(324743) snurportin 1
dog(487655) snurportin 1
chicken(770225) snurportin 1
cow(515588) snurportin 1
sheep(101105604) snurportin 1
76 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178374 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178374 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178374 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005701 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005701 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005701 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042581 Rosetta Predictions human pricing
NM_001042588 Rosetta Predictions human pricing
NM_005701 Rosetta Predictions human pricing
NM_001004270 Rosetta Predictions rat pricing
NM_178374 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042581 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310638 predicted 821
2 SASI_Hs02_00310639 predicted 1254
3 SASI_Hs02_00310640 predicted 1394
4 SASI_Hs02_00310641 predicted 847
5 SASI_Hs02_00310642 predicted 1399
6 SASI_Hs02_00310643 predicted 765
7 SASI_Hs02_00310644 predicted 935
8 SASI_Hs02_00310645 predicted 1363
9 SASI_Hs02_00310646 predicted 1063
10 SASI_Hs02_00310647 predicted 1346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042588 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310698 predicted 1060
2 SASI_Hs02_00310699 predicted 433
3 SASI_Hs02_00310700 predicted 754
4 SASI_Hs02_00310701 predicted 1127
5 SASI_Hs02_00310702 predicted 1157
6 SASI_Hs02_00310703 predicted 1123
7 SASI_Hs02_00310704 predicted 1116
8 SASI_Hs02_00310705 predicted 402
9 SASI_Hs02_00310706 predicted 410
10 SASI_Hs02_00310707 predicted 759
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005701 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340101 predicted 919
2 SASI_Hs01_00217183 predicted 1362
3 SASI_Hs02_00340102 predicted 1504
4 SASI_Hs01_00217185 predicted 946
5 SASI_Hs02_00340103 predicted 1497
6 SASI_Hs02_00340104 predicted 868
7 SASI_Hs02_00340105 predicted 1042
8 SASI_Hs02_00340106 predicted 1467
9 SASI_Hs02_00340107 predicted 1164
10 SASI_Hs01_00217190 predicted 1453
11 SASI_Hs01_00217184 predicted 368
12 SASI_Hs01_00217186 predicted 687
13 SASI_Hs01_00217187 predicted 1065
14 SASI_Hs01_00217188 predicted 383
15 SASI_Hs01_00217189 predicted 917
16 SASI_Hs01_00217191 predicted 1055
17 SASI_Hs01_00217192 predicted 814
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004270 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064733 predicted 626
2 SASI_Rn02_00198293 predicted 685
3 SASI_Rn02_00198294 predicted 529
4 SASI_Rn02_00198295 predicted 307
5 SASI_Rn02_00198296 predicted 282
6 SASI_Rn02_00198297 predicted 863
7 SASI_Rn02_00198298 predicted 940
8 SASI_Rn02_00198299 predicted 380
9 SASI_Rn02_00198300 predicted 541
10 SASI_Rn02_00198301 predicted 1007
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178374 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191292 predicted 555
2 SASI_Mm01_00191293 predicted 302
3 SASI_Mm01_00191294 predicted 382
4 SASI_Mm01_00191295 predicted 644
5 SASI_Mm01_00191296 predicted 328
6 SASI_Mm01_00191297 predicted 296
7 SASI_Mm01_00191298 predicted 957
8 SASI_Mm01_00191299 predicted 1051
9 SASI_Mm01_00191300 predicted 340
10 SASI_Mm01_00191301 predicted 883
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178374
VALIDATED
SNUPN MISSION shRNA Bacterial Glycerol Stock
snurportin 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198358    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178374.2-1153s1c1
Sequence:CCGGGATAGCCATTAGTGACCTTATCTCGAGATAAGGTCACTAATGGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178374.2-347s1c1
Sequence:CCGGGCTTTCTGAGTGGTTAATTGACTCGAGTCAATTAACCACTCAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182386    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178374.2-1141s1c1
Sequence:CCGGGAGGACAGTGATGATAGCCATCTCGAGATGGCTATCATCACTGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178374.2-186s1c1
Sequence:CCGGCAGAAATCCAAGCGGTTGGATCTCGAGATCCAACCGCTTGGATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178374.2-956s1c1
Sequence:CCGGGCTCCAACAGATTATTGAGCACTCGAGTGCTCAATAATCTGTTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178374.2-305s1c1
Sequence:CCGGCCCTAGCAAGAAGTTACCAAACTCGAGTTTGGTAACTTCTTGCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178374
VALIDATED
SNUPN MISSION shRNA shRNA Plasmid DNA
snurportin 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198358    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178374.2-1153s1c1
Sequence:CCGGGATAGCCATTAGTGACCTTATCTCGAGATAAGGTCACTAATGGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178374.2-347s1c1
Sequence:CCGGGCTTTCTGAGTGGTTAATTGACTCGAGTCAATTAACCACTCAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182386    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178374.2-1141s1c1
Sequence:CCGGGAGGACAGTGATGATAGCCATCTCGAGATGGCTATCATCACTGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178374.2-186s1c1
Sequence:CCGGCAGAAATCCAAGCGGTTGGATCTCGAGATCCAACCGCTTGGATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178374.2-956s1c1
Sequence:CCGGGCTCCAACAGATTATTGAGCACTCGAGTGCTCAATAATCTGTTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178374.2-305s1c1
Sequence:CCGGCCCTAGCAAGAAGTTACCAAACTCGAGTTTGGTAACTTCTTGCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178374
VALIDATED
SNUPN MISSION shRNA Lentiviral Transduction Particles
snurportin 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198358    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178374.2-1153s1c1
Sequence:CCGGGATAGCCATTAGTGACCTTATCTCGAGATAAGGTCACTAATGGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178374.2-347s1c1
Sequence:CCGGGCTTTCTGAGTGGTTAATTGACTCGAGTCAATTAACCACTCAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182386    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178374.2-1141s1c1
Sequence:CCGGGAGGACAGTGATGATAGCCATCTCGAGATGGCTATCATCACTGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178374.2-186s1c1
Sequence:CCGGCAGAAATCCAAGCGGTTGGATCTCGAGATCCAACCGCTTGGATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178374.2-956s1c1
Sequence:CCGGGCTCCAACAGATTATTGAGCACTCGAGTGCTCAATAATCTGTTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178374.2-305s1c1
Sequence:CCGGCCCTAGCAAGAAGTTACCAAACTCGAGTTTGGTAACTTCTTGCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005701
VALIDATED
SNUPN MISSION shRNA Bacterial Glycerol Stock
snurportin 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038569    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005701.2-1280s1c1
Sequence:CCGGGCTGGAAACAGCTTATCTATACTCGAGTATAGATAAGCTGTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005701.2-343s1c1
Sequence:CCGGCACTGTCAAGAAGTTACCAAACTCGAGTTTGGTAACTTCTTGACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005701.2-593s1c1
Sequence:CCGGGATTGCATTTACAATGAGGTACTCGAGTACCTCATTGTAAATGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005701.2-798s1c1
Sequence:CCGGGCCTGTGTGATGTGCTATCTACTCGAGTAGATAGCACATCACACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005701.2-673s1c1
Sequence:CCGGCCAGACTGATTTCCGATTCTACTCGAGTAGAATCGGAAATCAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005701.3-752s21c1
Sequence:CCGGATGCTTTCTGAGTGGTTAATTCTCGAGAATTAACCACTCAGAAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005701.3-1167s21c1
Sequence:CCGGGCCTGTGTGATGTGCTATCTACTCGAGTAGATAGCACATCACACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005701.3-1649s21c1
Sequence:CCGGGCTGGAAACAGCTTATCTATACTCGAGTATAGATAAGCTGTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005701.3-712s21c1
Sequence:CCGGCACTGTCAAGAAGTTACCAAACTCGAGTTTGGTAACTTCTTGACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005701.3-1508s21c1
Sequence:CCGGGGATGCCTCATGGAGAATTAACTCGAGTTAATTCTCCATGAGGCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005701
VALIDATED
SNUPN MISSION shRNA shRNA Plasmid DNA
snurportin 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038569    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005701.2-1280s1c1
Sequence:CCGGGCTGGAAACAGCTTATCTATACTCGAGTATAGATAAGCTGTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005701.2-343s1c1
Sequence:CCGGCACTGTCAAGAAGTTACCAAACTCGAGTTTGGTAACTTCTTGACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005701.2-593s1c1
Sequence:CCGGGATTGCATTTACAATGAGGTACTCGAGTACCTCATTGTAAATGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005701.2-798s1c1
Sequence:CCGGGCCTGTGTGATGTGCTATCTACTCGAGTAGATAGCACATCACACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005701.2-673s1c1
Sequence:CCGGCCAGACTGATTTCCGATTCTACTCGAGTAGAATCGGAAATCAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005701.3-752s21c1
Sequence:CCGGATGCTTTCTGAGTGGTTAATTCTCGAGAATTAACCACTCAGAAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005701.3-1167s21c1
Sequence:CCGGGCCTGTGTGATGTGCTATCTACTCGAGTAGATAGCACATCACACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005701.3-1649s21c1
Sequence:CCGGGCTGGAAACAGCTTATCTATACTCGAGTATAGATAAGCTGTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005701.3-712s21c1
Sequence:CCGGCACTGTCAAGAAGTTACCAAACTCGAGTTTGGTAACTTCTTGACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005701.3-1508s21c1
Sequence:CCGGGGATGCCTCATGGAGAATTAACTCGAGTTAATTCTCCATGAGGCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005701
VALIDATED
SNUPN MISSION shRNA Lentiviral Transduction Particles
snurportin 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038569    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005701.2-1280s1c1
Sequence:CCGGGCTGGAAACAGCTTATCTATACTCGAGTATAGATAAGCTGTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005701.2-343s1c1
Sequence:CCGGCACTGTCAAGAAGTTACCAAACTCGAGTTTGGTAACTTCTTGACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005701.2-593s1c1
Sequence:CCGGGATTGCATTTACAATGAGGTACTCGAGTACCTCATTGTAAATGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005701.2-798s1c1
Sequence:CCGGGCCTGTGTGATGTGCTATCTACTCGAGTAGATAGCACATCACACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005701.2-673s1c1
Sequence:CCGGCCAGACTGATTTCCGATTCTACTCGAGTAGAATCGGAAATCAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005701.3-752s21c1
Sequence:CCGGATGCTTTCTGAGTGGTTAATTCTCGAGAATTAACCACTCAGAAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005701.3-1167s21c1
Sequence:CCGGGCCTGTGTGATGTGCTATCTACTCGAGTAGATAGCACATCACACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005701.3-1649s21c1
Sequence:CCGGGCTGGAAACAGCTTATCTATACTCGAGTATAGATAAGCTGTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005701.3-712s21c1
Sequence:CCGGCACTGTCAAGAAGTTACCAAACTCGAGTTTGGTAACTTCTTGACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005701.3-1508s21c1
Sequence:CCGGGGATGCCTCATGGAGAATTAACTCGAGTTAATTCTCCATGAGGCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks