EMAIL THIS PAGE TO A FRIEND

SNURF

SNRPN upstream reading frame

UniProtKB ID: Q9Y675, A6NCW2
Gene ID:
Human(8926) Summary: This gene encodes a highly basic protein localized to the nucleus. The evolutionarily constrained open reading frame is found on a bicistronic transcript which has a downstream ORF encoding the small nuclear ribonucleoprotein polypeptide N. The upstream coding region utilizes the first three exons of the transcript, a region that has been identified as an imprinting center. Multiple transcription initiation sites have been identified and extensive alternative splicing occurs in the 5' untranslated region but the full-length nature of these transcripts has not been determined. An alternate exon has been identified that substitutes for exon 4 and leads to a truncated, monocistronic transcript. Alternative splicing or deletion caused by a translocation event in the 5' UTR or coding region of this gene leads to Angelman syndrome or Prader-Willi syndrome due to parental imprint switch failure. The function of this protein is not yet known. [provided by RefSeq, Jul 2008]
Mouse(84704) SNRPN upstream reading frame
Rat(113938) SNRPN upstream reading frame
Domestic Rabbit(100009465) SNRPN upstream reading frame
cow(282076) SNRPN upstream reading frame
dog(606883) SNRPN upstream reading frame
122 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033174 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033174 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033174 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022804 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022804 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022804 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005678 Rosetta Predictions human pricing
NM_022804 Rosetta Predictions human pricing
NM_130738 Rosetta Predictions rat pricing
NM_033174 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005678 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071983 predicted 730
2 SASI_Hs01_00071984 predicted 370
3 SASI_Hs01_00071985 predicted 627
4 SASI_Hs01_00071986 predicted 627
5 SASI_Hs01_00071987 predicted 687
6 SASI_Hs01_00071988 predicted 348
7 SASI_Hs01_00071989 predicted 339
8 SASI_Hs01_00071990 predicted 316
9 SASI_Hs01_00071992 predicted 322
10 SASI_Hs02_00340069 predicted 403
11 SASI_Hs01_00071991 predicted 750
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022804 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149858 predicted 144
2 SASI_Hs01_00149859 predicted 136
3 SASI_Hs01_00149860 predicted 362
4 SASI_Hs01_00149861 predicted 338
5 SASI_Hs01_00149862 predicted 299
6 SASI_Hs01_00149863 predicted 321
7 SASI_Hs01_00149864 predicted 233
8 SASI_Hs01_00149865 predicted 170
9 SASI_Hs01_00149866 predicted 224
10 SASI_Hs02_00356103 predicted 142
11 SASI_Hs01_00149867 predicted 125
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130738 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047828 predicted 218
2 SASI_Rn01_00047829 predicted 212
3 SASI_Rn01_00047830 predicted 222
4 SASI_Rn01_00047831 predicted 219
5 SASI_Rn01_00047832 predicted 204
6 SASI_Rn01_00047833 predicted 227
7 SASI_Rn01_00047834 predicted 203
8 SASI_Rn01_00047835 predicted 240
9 SASI_Rn02_00267470 predicted 291
10 SASI_Rn01_00047836 predicted 102
11 SASI_Rn01_00047837 predicted 58
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033174 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337305 predicted 383
2 SASI_Mm02_00337306 predicted 570
3 SASI_Mm02_00337307 predicted 416
4 SASI_Mm02_00337308 predicted 729
5 SASI_Mm02_00337309 predicted 382
6 SASI_Mm02_00337310 predicted 488
7 SASI_Mm02_00337311 predicted 484
8 SASI_Mm02_00337312 predicted 577
9 SASI_Mm02_00337313 predicted 495
10 SASI_Mm02_00337314 predicted 731
11 SASI_Mm01_00041756 predicted 221
12 SASI_Mm01_00041757 predicted 256
13 SASI_Mm01_00041758 predicted 232
14 SASI_Mm01_00041759 predicted 258
15 SASI_Mm01_00041760 predicted 245
16 SASI_Mm01_00041761 predicted 257
17 SASI_Mm01_00041762 predicted 213
18 SASI_Mm01_00041763 predicted 235
19 SASI_Mm01_00041764 predicted 198
20 SASI_Mm01_00041765 predicted 231
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033174
SNURF MISSION shRNA Bacterial Glycerol Stock
SNRPN upstream reading frame
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431217    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033174.2-475s21c1
Sequence:CCGGTTAGTGTTGACAACGGCTATTCTCGAGAATAGCCGTTGTCAACACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033174.2-130s21c1
Sequence:CCGGTACACTTGAGAAGAACTACTGCTCGAGCAGTAGTTCTTCTCAAGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033174.2-166s21c1
Sequence:CCGGAGGTCGAGGTCCAGGTCAAACCTCGAGGTTTGACCTGGACCTCGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033174.1-204s1c1
Sequence:CCGGCGTTCTCAGCAACAGCAAGTTCTCGAGAACTTGCTGTTGCTGAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033174.1-176s1c1
Sequence:CCGGCAACCAAGAGTGTCACTTGTACTCGAGTACAAGTGACACTCTTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111930    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033174.1-300s1c1
Sequence:CCGGGCAACTTCAAGGTGGTGGAATCTCGAGATTCCACCACCTTGAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033174.1-269s1c1
Sequence:CCGGTGAGACACCAAGAGGTGGTTACTCGAGTAACCACCTCTTGGTGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033174.1-246s1c1
Sequence:CCGGGAACTAAGACAGGCATTCTTACTCGAGTAAGAATGCCTGTCTTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033174
SNURF MISSION shRNA shRNA Plasmid DNA
SNRPN upstream reading frame
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431217    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033174.2-475s21c1
Sequence:CCGGTTAGTGTTGACAACGGCTATTCTCGAGAATAGCCGTTGTCAACACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033174.2-130s21c1
Sequence:CCGGTACACTTGAGAAGAACTACTGCTCGAGCAGTAGTTCTTCTCAAGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033174.2-166s21c1
Sequence:CCGGAGGTCGAGGTCCAGGTCAAACCTCGAGGTTTGACCTGGACCTCGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033174.1-204s1c1
Sequence:CCGGCGTTCTCAGCAACAGCAAGTTCTCGAGAACTTGCTGTTGCTGAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033174.1-176s1c1
Sequence:CCGGCAACCAAGAGTGTCACTTGTACTCGAGTACAAGTGACACTCTTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111930    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033174.1-300s1c1
Sequence:CCGGGCAACTTCAAGGTGGTGGAATCTCGAGATTCCACCACCTTGAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033174.1-269s1c1
Sequence:CCGGTGAGACACCAAGAGGTGGTTACTCGAGTAACCACCTCTTGGTGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033174.1-246s1c1
Sequence:CCGGGAACTAAGACAGGCATTCTTACTCGAGTAAGAATGCCTGTCTTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033174
SNURF MISSION shRNA Lentiviral Transduction Particles
SNRPN upstream reading frame
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431217    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033174.2-475s21c1
Sequence:CCGGTTAGTGTTGACAACGGCTATTCTCGAGAATAGCCGTTGTCAACACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033174.2-130s21c1
Sequence:CCGGTACACTTGAGAAGAACTACTGCTCGAGCAGTAGTTCTTCTCAAGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033174.2-166s21c1
Sequence:CCGGAGGTCGAGGTCCAGGTCAAACCTCGAGGTTTGACCTGGACCTCGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033174.1-204s1c1
Sequence:CCGGCGTTCTCAGCAACAGCAAGTTCTCGAGAACTTGCTGTTGCTGAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033174.1-176s1c1
Sequence:CCGGCAACCAAGAGTGTCACTTGTACTCGAGTACAAGTGACACTCTTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111930    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033174.1-300s1c1
Sequence:CCGGGCAACTTCAAGGTGGTGGAATCTCGAGATTCCACCACCTTGAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033174.1-269s1c1
Sequence:CCGGTGAGACACCAAGAGGTGGTTACTCGAGTAACCACCTCTTGGTGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033174.1-246s1c1
Sequence:CCGGGAACTAAGACAGGCATTCTTACTCGAGTAAGAATGCCTGTCTTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022804
SNURF MISSION shRNA Bacterial Glycerol Stock
SNRPN upstream reading frame
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000419956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022804.2-282s21c1
Sequence:CCGGGGTGGATTTCCAGGCTGAACTCTCGAGAGTTCAGCCTGGAAATCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022804.2-323s21c1
Sequence:CCGGAGACACCAAGAGGTGGTTAAACTCGAGTTTAACCACCTCTTGGTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022804.2-353s21c1
Sequence:CCGGGAGTAGCGAGGAATCTGATTCCTCGAGGAATCAGATTCCTCGCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022804.2-334s21c1
Sequence:CCGGGGTGGTTAAAGCCATATTGGACTCGAGTCCAATATGGCTTTAACCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022804.1-95s1c1
Sequence:CCGGCGAACTACAGAACAGCACGTACTCGAGTACGTGCTGTTCTGTAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022804.1-88s1c1
Sequence:CCGGCCTGAGACGAACTACAGAACACTCGAGTGTTCTGTAGTTCGTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022804.1-163s1c1
Sequence:CCGGCAACCAAGAGTGTCAGTTGTACTCGAGTACAACTGACACTCTTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022804.1-191s1c1
Sequence:CCGGCGTTCTCAGCAGCAGCAAGTACTCGAGTACTTGCTGCTGCTGAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022804
SNURF MISSION shRNA shRNA Plasmid DNA
SNRPN upstream reading frame
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000419956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022804.2-282s21c1
Sequence:CCGGGGTGGATTTCCAGGCTGAACTCTCGAGAGTTCAGCCTGGAAATCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022804.2-323s21c1
Sequence:CCGGAGACACCAAGAGGTGGTTAAACTCGAGTTTAACCACCTCTTGGTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022804.2-353s21c1
Sequence:CCGGGAGTAGCGAGGAATCTGATTCCTCGAGGAATCAGATTCCTCGCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022804.2-334s21c1
Sequence:CCGGGGTGGTTAAAGCCATATTGGACTCGAGTCCAATATGGCTTTAACCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022804.1-95s1c1
Sequence:CCGGCGAACTACAGAACAGCACGTACTCGAGTACGTGCTGTTCTGTAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022804.1-88s1c1
Sequence:CCGGCCTGAGACGAACTACAGAACACTCGAGTGTTCTGTAGTTCGTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022804.1-163s1c1
Sequence:CCGGCAACCAAGAGTGTCAGTTGTACTCGAGTACAACTGACACTCTTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022804.1-191s1c1
Sequence:CCGGCGTTCTCAGCAGCAGCAAGTACTCGAGTACTTGCTGCTGCTGAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022804
SNURF MISSION shRNA Lentiviral Transduction Particles
SNRPN upstream reading frame
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000419956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022804.2-282s21c1
Sequence:CCGGGGTGGATTTCCAGGCTGAACTCTCGAGAGTTCAGCCTGGAAATCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022804.2-323s21c1
Sequence:CCGGAGACACCAAGAGGTGGTTAAACTCGAGTTTAACCACCTCTTGGTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022804.2-353s21c1
Sequence:CCGGGAGTAGCGAGGAATCTGATTCCTCGAGGAATCAGATTCCTCGCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022804.2-334s21c1
Sequence:CCGGGGTGGTTAAAGCCATATTGGACTCGAGTCCAATATGGCTTTAACCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022804.1-95s1c1
Sequence:CCGGCGAACTACAGAACAGCACGTACTCGAGTACGTGCTGTTCTGTAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022804.1-88s1c1
Sequence:CCGGCCTGAGACGAACTACAGAACACTCGAGTGTTCTGTAGTTCGTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022804.1-163s1c1
Sequence:CCGGCAACCAAGAGTGTCAGTTGTACTCGAGTACAACTGACACTCTTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022804.1-191s1c1
Sequence:CCGGCGTTCTCAGCAGCAGCAAGTACTCGAGTACTTGCTGCTGCTGAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks